Description :
From Genome Similarity Track
Location :
Scaffold_47:64758- 68106
Transcript NameFunction/comments
Phyke_g2406conserved hypothetical protein
Phyke_g2407hypothetical protein PHYSODRAFT_513680
Phyke_g2408hypothetical protein PHYSODRAFT_487245

Sequence
3348 bases(100 bases per row)
GCGGCAGTGTGACGAGTTCGTGCACTCGCGATTTTCGTGTGTCAGTCTGAAGTGCCGCAAATGCAGCAGGGGCCATCACCGATAGCGTTTGCTTCACTTG
AAGAGCGGATCGCGCACTTAAATTGGAGAAAAGTCTGTAATGAGCGAGAGATTCAGGGCACGCTTCGGTTCAGTAAGCAGCTCCAAGAGAGGGACGAGTT
CATTCGCGCCGCCAAGAGCGGGGGCAAAGAACATCGTGAACGgatgcagcaagtgatcaAGGACGAATTCACCAAGCCGTTGCCCGTGACAGCCCAGTTT
TATCAGGAGCTCACAGCACAGCAACGAGAAAACGAGCTGAAGACACAGGCGGCAGCCGAGCGGCAtatgaagcagctgcaaactATTCAGACGAAACTGG
ACGCCCGCGAAGTGCAGATGACACGCAGGAAGGAGTtcgagcgcaagaagaaggagctgttCGCCGATGCTTAACTATCTGAGGCTAGCATTTGAAATAT
ATTGCCAGGTTGGCAGCAAACCTCTCAACGGAATGTGAGCAGTTCGATGTCGAAGATGAGATTTGTGTTTGGCGGCACGAGCCCTGGGAACCCTTTTCGA
CCGTAGGCTTTATCGGCAGGCACGAACAATTTAGCACGCTCTTTCATGCACAACCTCTCCACACCTTCGTCTAGCCCTGGGATTACTTGTTCAGCGCCGA
GTTTGAACTTGAAGGGCTTCTCACGGTCACGTGAGGAATCGAACTTCTTCCCATCCTGAAGCTGCAATTTAGCAAGACATCAAATCATGACAACGAATAG
TCATTGTTCAGTGCGGCCATAATGTGTGAGGTAGTTGCTCAGATATTTGAACGCACATATCCCGTGTAGTGAATAACCACAGTTTGGCCCTTCTTGGGAT
AGTTGAGTCCATCGCCTGCCACGAACACTTCCACCTGAATCTCACCGTGGCGCTGTAGACGTTGAAGTTCACTTTGTGATCAACCTTATGCGCGGTAGTG
TCTTCAAGAGCAAGTATTAACGCACCACATTGGAGATGACAAAGTCCTTGGGCTCCATCATGGTCACTGTTGAGTGGAGAACTCTACTACTAGCGGAGGG
CGATCAAGAATGGATAGCACTTGAAATGAACGGGACAAAGATTGCATGGTCATCCTCAAAATAAACAGCACATGTAACGCAGCAATACAGGAAGTCGTTT
GTCTGCGTTCACTTTCGAAGCCAAAATACTACTGGTAGCGATGGCTTCAGGATTCTCCTCGCCCAGACAATACCCCAACTCAGTCCTTCAAATGCTCTGA
TTTGTGTTTCGGACTCGCTttctttgtcgtcgtcgtcgtaggCGATGACATCTTAGCCTTTGTTTCAGCAACACTTCCTGCACCAGTTTTTCCTCCAGGA
TAGAGAAGAATCAGGGACACTTGAATCACCCCCATGGACAGCGCGAAGAAGTTGGGGCAAATGACCAACGGGTCACCCAACATCACTCCGTACGTGGCCC
AAATGGTACCCGACACGACGTTCATCGTCGACATGCCAAAGGGCAAACAGGACGCATCCTTCCGACGCAAAATGCTCTTGACCTGCAGCAACGGCGACGC
GGCCGTGAACACCGACAAGATGTTGGCTGGGATGCCCGTGATCATCTGCGTTTCCTCCAGCTCCCGAGTCATCACCTGATGGGCCAGTAACAAAATCACC
AGCATCGCTGACGTCAACATCCTGGTGGCTTGGGTCCTGTCCTTGGTGTACTTGTAGAAGACCAGCACGTAGTACGAGCCCAGCACTGCGCCAAGCAGCG
ACGTCCCTCCCACGACGACATTGGATGTCGTATAGCCATACAGAGTGTAGATCGCACTCTGCACaaagtagaagaagaagggcgCGAATGAGAACTGCAG
CGTGCTGCGAGAGCGACGGATCGTCGAGATGGTAGGCCTGGGTTTTAGGGGGGGGGAGGGATAAACGATAGATAAGAGTAAGAAATAAGGGCCGAAAATG
CAGGGATAAGGACGGGTTACACACCATGGAGAGATGGCGAACACGATGGAGGAGCCCACAGCTACGATGGGGACCGATTTGACCGCCAGGAAGTACGACA
TGTACGCCGCGTTAGACAGCGACTCCCACGACATGTTTGTTGCTTTTTATTGTATTGGAAGGAAGCGGAATGGAGACACGTGGTCAAAATATCAATTGTA
TTAAATTTATCAGGTTATCGTAAATAAACAATGAATGATTTTACTAAATACTGATACTTTCATAGACTAAAATATGGATTGTTGAAGGATATAAAATACC
AATTTAGAGCTCAATTAATGGTTggtcaagatggctacatgtccatgttgaagtcaaGTGTGAGGACACTTTGCTTGTCATGCAATCGGTCTTGCTTCAG
ACAGCACGTCTCTTTCTCTACTGGCGGTGAACCACGTACATGACTGTGGGAAAGATACTTGGCCAGTCTGCTCGCTCACTTTCCACCGAACTAGCAGCAC
GTTGAACGTACGGATCAGTTTCCGTGGTATGCACCGTGCCAACAACAGTATCACCACGTCTTGGGCTTGATACACGTGCTCGCCGTAGAATAAAAAGCCA
GTGAGCAGTACAGCTTCCACATTCGAGTAGCGGACATTTTTATGCTTCACGTACGCGATGTCACTGCAGTCGGTGAAGACCCTGGCGAATGGCACACCTA
GACAATGCTGTTCGAATGTCGTAAGCGGCCTGAACAGGGAATTCGATCTGCACCACGGTATGCAATTCTCGTTAGGGCCCATGTTCGGTGCCGCATCTCT
GTGGTGTCCTTGTTCAGGATTGACCCGGTGTCGGAAGCCTGGGATTCTTAGTACCTTTGAGGCTGCGGGGTTTGGTTCCAGGGTATTGCAGCTTGGTGAC
ACATGCGGACCGACGGCATGCAGTTTTCTGTTGTCTATTATCACTGTTTGGCGCTCGCTGCTACTGTGGCGTTGTCGACCCCACTTTTGAAGCACCATTG
TGACACCGGCGGCAACAAAACCCAGTCCGAGAGACACAACGGTCAAAGCAAGGGCCATATTGTGCTTGAACACAACACACGAATCTCGCAGCTTGCACAG
AGCTGCACCACCGTCCGAAGTTTTCCGCAACAGCTCTCCGTTCATGTCGATAATAAACGACAGCGACGTGGCGCGAAAAGAATACAATGCAAACGCAATG
CAAGACACCATGATCAGCTGAATGAGCTCCCATGTCAGTCGAAAGTGgcgagcaagctgctgctctcccGATCGTGCCTTCAGCATATTCACGAACGAGT
ACGAGAATGCGAAGAAGCACAAGGTCAGATTGCTCAGCGATTCAACTG