Description :
From Genome Similarity Track
Location :
Scaffold_884:6475- 11852
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_884-snap-gene-0.10Cell division cycle 6
Pytar_ATCC12531maker-par_contig_884-snap-gene-0.11Metalloprotease family M48X
Pytar_ATCC12531maker-par_contig_884-fgenesh-gene-0.4Fumarylacetoacetate (FAA) hydrolase

Sequence
5377 bases(100 bases per row)
GAGGTGAGGAGGCTCGAGCGTGCGCACTGTCTCAGCATCCCGACGGCGCGGCGTGCGTCGCCATCACGGGCCGCGACCTTGCGCGCAATGAGCTCGAGCG
CGCGCGGCTCGACGACGTCGGCGACTGGTATGGCGTCGGCCGTGGCCATCTGCACGTACGCCGTGAGGATGGCCGTGAGCTCGTCGAGTGAGTAGGACGG
GAAGAGCACGACGCTCGTCGGGTGCGGGTCCTGCGCGAGAAAGGCGGCAATCTGCGCGTGCATGTCGACGCCGTTGAGAATGCCAATGACGCGCAGCGCG
GCGTTCGGCAAGTAGGCCCAGCGCACGAGGAAGGCGAGCAGTTGCTGGGCTTTGGTCTTGAGCGCGGCCGACGGCAGGCGCACGAGGTGGTCCACTTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGCACGAGCACG
CAGTCCTGTTGCTCGGCAGTCTGAGACGACGAGCGGTGGAGAGACGACGTGAGGAACGCGTCGAGCTGCTGCGCGTGGTNNNNNNNNNNGGGCGACGCGA
ACGTGCTGCAGTTGAGGCGCACGACCTGCGAGTCCGCGCGCGAGTGGAGCGCCGCGACGTGGGCCACGCACGACGACTTGCCCGTGCCCGGCGGGCCGAT
CACAAACAGCGCACGCGTCAGCGCGGCGGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTCTTCGGCGCGGCCCACAAACAGGGGCGCGTGGTCGTC
GCCACTGGCGATGCGCTCAAGCACAGCGCGTGGCGACGTCGGAGCGTCGGGTTTGGTGGCGTCATGGGCGTTGGCGCTGGTAGTTGGCGCCGTGCAGTAG
TCCAGCGTGCGGCGGATCGTCAACGCCTTGGTCGCCTTGGTCGATGCCGGCGAAGACGGTGGGCGGCGCTTGGCGCCGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGCGGCAGACACGACGGCGGTGGGC
TCGTGCTGGACGAGGCGGAGGGCGACGAGAGACTGTGCTTGCGCTTGCGGGTCTTCTTCTCGGGCGTGATGAGCGAAGCGGGCGCGGCGACGACGGGACC
GTTGGAGGCTGCCGACACGGCGTTGGACGCGTCGACGCGTGGGGAAGGGCGTGGGGCGACCTGTGGCTGGCGGGAGGCCGCGATGGCCGCGGNNNNNNNN
NNNNNNNNNNNNNTTCCTTCCATGCGTTCAATTGGGCGCGCGTGCGCATGGCTGTTGGTAGAGCGCGCGGAGTTGGCGTTGGTAAAGTTGGCGTTGGTAA
AGTTGGCGTTGGCGCTGAATGCGGGAGTGACGTTTTGCCAACGGCGCGGCAGTTTGTTGGCGGATCGCCAACTCTTTCCTCCAAAGCGCGGGGTAGAAGA
TCACCAATTTGGACCAATAGATGGGCTCCATATGACAGGCAGTCAATTTGGACCAATAGAAAGAATGCACTCTTTCCCGCGCTCATATACCGTCTCTACT
AAAACCGATTCTGCTTGTCTCACACGTCACAGATACAGAGACACACACGGATTTTGTGACTGACACAACTGTGTGCTGTATCTGTGACGTGTGAGAATGC
CCAAGATGGATATGGTTGCTGTTGTGATACTCCGGGTATTGTACATTTGAGATTGATGCCGTTGTCTATGCTCTATTCTATCTATCTACAACGTGGTCGA
TCACATCTTCATGCAGTAGAGGCAGCTCGAGTGACTGTCGTGGACATTTCGATCCACTGTGTGGTGGCCGTGGGCAGCTGCCGTTCCCTGCGCAATGAGC
TTGAGGTGGTGAATGCGAGAGGTCAAGAATGGGTGAGCCGTGTCGCCGAGGTAGTTGCCTTCCTTTGTAATCATGCGCGTATTCATGAGCGATCGCAGCT
CACAGTTGTGGGAGAGTTTGCGCTGGAAGCAGTGGATGCCGCCGTGGACGAAGCCGCTCTCGGCCGCAATGTGGTCGGCCTCGTGCTCAAGCCGCCACGA
AACCAGCATGTTGCCAGCCACCAAGCCGACACAACTGACAATTGACGCGACGAATGTGTTGGGGATCCGCTTGATGGCGGAGCAGCTTGCAATAACCGAC
AGCGGCAGAAACGTGCCGGAGATGATCGAGTGGTTGCGCGCGATGTGGGCGGCCTCGTGGGCGAGCACAAAGTCGACTTCTTCCTTGCTGGGGATCTGGC
CCGTGAACTTGCGGCGCAGCTCATCGGTCGCAAAGAAGGCGTCGTACAGATCGAGGGGGAGCACGATACACGCGCCGCGGAATCCGATGGTCGCGTTGGA
CCCGATCGACGCGCCGGACGTTTCCTCGCCGACCCGGACCGACAAGTTTTCCGGATTTTTGACGCCAATGCGGGCCGCGATCTTGCGGACATTGACTGCG
AATGGGTCGCTACGCTCGAGCGGGACCGAATCGGAGCCCTGCGCGAGGCTCAGTGACAAGTCGCTCGTCGGCGCGGCCAGCGGGAGGCTTGAGAACGCGT
ACATGGCGAGCGCCGATGTGCCGACGAAGCGTCGTGTGATGGCGGCGGTGGACATGATGGCGATGATGCGCTTTTTGGCAAGTGCCCATGCTGCCGACAT
GGAGGAGGTTGGTGCCGCACACATGTGGTCGTCGTGGCGCACGTCTTTGCAGTACACGCCGCTTATCTTTGTCGTCCACTATGCCAAATCAGTGGTGGGT
GACTTCGATCAGACTCGCCCACTACTATCTCACGACGACGTGGAGACCTTCCCGAGCGTGTCTCTTGGGACGGTGCTGGAGACACGAAGCCCCGCGGGTG
ATGAGATGGCTTCCTTCTTGTGACTTGCTCGATTCGCTGCGTTGCTATGGCACCGAGATCAGTACACGGTACAGTATCACCCTGACCCAATATAACTCGA
GGTTCGAGTGCCGAAGGCGTTCTGAAGAGGGGCCGCCTCCACGCGTGAGATTCGATTGTGGGGCGGAGAATCCAATGGGGTGAAATGGCGCAGCGAGTGG
AGTCGGCATGGACCACCCACGTACGCAGAAGAACGAGGGGACGTCGCCAGCGTCGACGGGATCACTGACGTAGGACCATCACTCTATGGTGTACCTGCTC
GACGTGACGCCATCAGCCAATTAAATCCAGAGTATCCGGACCAACCGACTATTTTGACACCTGTGTAAAGTGTTATTTTGACACTTTTGTACCACAAATA
GTGTCAAGTTCTGGCCGCGAGCGTTAAACGGTCAAAAACGTGCACCTCGGAAGCGAAGGAAGGTTTTGGCCGTTTAACGCAGACTGTCTCATATCGATAC
TGTACGGTGCAGAACAGTAGAAGAAGAAACAACTTACACTCAGTTATTTTGGGTCACACGGCATCATAAATCTGGGTAGCAGTGAATCGTAGCTGGAAAA
CCCAAAGCTTAGAACGATAGCGTGTTCTCACAACGCGGACGCGCCCACTACGGGGTTCACGAGCTTGCCGATGCCCTCGATGGAGATTTCCATGACGTCT
CCAGGCGCTAGGAACACTGGCGGGCTGCGCGTGAAGCCCACACCCTAATCAAGGACAGGTTAGTCTACGTATTGAACATGCGCAAGGTTAAAAGTACTCG
CTTACCTCGGGCGTGCCCGTGATGATGAGCGTGCCACGCGGCAGCGTCATATCCTGTGAGAGCTGGCTAATCAGCTCGGCGACTGGGAAAATCATGTCGC
CCGTCGACGACTTCTGCATGAGTTTGCCGTTCAAGACGGTCGAGATCTCGAGTTTCTGTGGGTCTGGGATGATTTCGGGCGTGACTAGCACGGGCCCGAT
CGGACAGAATGTATCAAAGCTTTTGGAACGGCACCACTGGCCACCACCGCGCTTGCCCTGCCAGCGACGCGCCGAAATGTCGTTCGCGCACGTGTAGCCA
CCCACATACTTGAGCGCGTCTTGGACCGAGACGTTCTTGCATGTCTCCTTGAGCACGACCGCGAGCTCGCATTCATAGTCGAGTTCCGGAGGATCGGATG
CGATGCGTGGGATCACGACGGGGTCATTCGGGTGCTGAATCGTGTTGAGCCCCTTGGTGAAAAGCACGGGCGTCTGCGGCTCGGGCATGTTGGTCTCCTT
GGCGTGCTTGCGGTAATTGAGGCCGATACAGAGAATCTGCGACGGCACGACAGGCGCGAGCAGCTTCTTGATCGTCGCCTGCTCGCCCGTGAACTGGAGA
CTCCCCAGTGGGTCATTGTTCTCAACGAGGCGGACGGTGGCGCTGCCTTCTGCGACGCGCTGCCCGCAACGTGTCGCGCCGGTCGTGTCGACAAAGCGGA
CGAGATGCGTCGCGCGGCCGCTGCTCTTCGTGCTGTAACCCATGGTGGCGCTGTGGAGCGATTGAGCCGCTGAGACGCGTGGAGATGAAAGCAGGGAGCG
AGCCCGACGCCTCACAAGAACCACCATGGACGGATCTTTGTCGGATGCTGGCATCTCGCACAGAGAAAGGGATCCACTTGGTTATAGTGTGGACCACCTG
ACACACGGACTATTTGGGGTGGACAACATCAGAAACATATATCGTAGCCATATCATATTCGACAGGTTTTCCCCTTCAGATCACTGGGAACGACATGTCG
GTGAGCATGCCGCAAGTGCCAGTGGAGGCCGCACCACGTCGAAGCCGCACATACCCGTTCTCACCCCAGCGCGTTCCCCACGAGTTTTTAATCTTGATGG
ACGTGGCGTCATAGCCGATTGCGATCACTGCGTGGTCGACGCGCCCGTTCGGACAGGACGTCACAACGCCGCTCTTGTACTGCTTCCAAACGGCGTTAGC
GGCGTGCACGGCGATCACCACGGGCTGCTTGTTGAGCGCTGTGACAAGACCAGTCTCGCCAGTCACGCGTGTGATACCCTTCATGCCCACATGCGTCTTT
TGGCACGTGTTGCTGCACGCCGGTGCTCGACCACCANNNNNNNNNNNNTACGGGTACGCGGCGCTCGTGCAGAGACCTGTCTGCTGGATATATCTCAGGG
CCCCGCCGATCGTGCCGCCGCCACAACCGGCATTCGTGCGGTCGCAACTTGTCAGCTGCTGCTCAGAGTACTTGTTGGCTCTGCCACCAAGCGCAAGGCA
TTGCACCGTCTCCACGACGCCGACCGTTGCGAACGCCCAGCACGAGCCGCATTGGCCCTGTTGTTGCACCGGCGTGT