Description :
From Genome Similarity Track
Location :
scaffold_1053:6475- 7747
Sequence
1272 bases(100 bases per row)
GCTTGGTCGGTCAATCCCCACCAAGCTCGTCTGAGTGTTGGTCAGTTCCGCAAAAGACCTCAAGTCTAGAACTTGCATATCATACATAATAACAAAGTTA
GTATGTGTTTTATACAACATGTCCAACTTGGCAACAAAATAGAACGTTCTCCGCGTGAAGAACACATGCGCGGGGAGTCACTTACTGCATGCAGTATGCT
GTAGTAGCGCAGCAAGTCTAAACAACTTGGTTCCCCACTTGTGTGGCTTGTCCTTCATGAACTGCCTGGTCACGTTGTGACGGCTTCTCGAATGGATCAT
GGCTTCATCAAAGGTCATGACTGGAGGTACGTTGAAGCCTTTCAAAAACGTTGTCTGTAGCGTGTCGACCACGGAGTGAACCTTCCAAGCTCTGTCCGTC
CCCGCTCTCGCATCTGTATTGTCGGTAAAATGCAAATTCTGCATTACACGACCGAATCGTGCATTCGGCATATAGCAGTCGAATGTACCCTTTTGGCACA
GCACCCACTCCAGTCTTCGCTCAGTGATCAGCGAATCGACGCTTGTGAGGGCAGAGCATTCTGGCGACCAATAACCCGATACAGTGGACAATCTCTTCCG
CGTTGATCTTCTTGTGTTTAGTCGTCTCTTGCCGAAGCACCTCCTTTCTTGTTGCATCAGGATCTTGCGCCACCTTCCTCTCGTACATACAATCCACACG
CTGGTTCAGGTGCTGATGGTAATACCGGTTGCTTTCACTCGCAATCTGAAGCCACAGTCTTGGGGGCATAACCAAAAGTAAGGTCACTTGAGCACTTGAT
GTCAGAATGTAAAGTGAGTTGATTGAGGTCCTTAGTTCGCAACACTGTGCTACCTCTAAGTCTACTGGATACTCCTGCTGGATACACTCTACTGGATTCT
CTACTGGATACTGACTTACCTTAGCCAATCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCTCCGTAGC
GTAAACAGCGTCCCATCATCAGCGTCCCGTAATCACAGGAATGATTGCGGTCCCACTGAGTGATGGTCATACCGGTATCTACCGGTATTCCGCAGCTAGT
CGAGGCGTCATCTTGCCAACACTCCCACTCGACTCGACAGCCATCGATGCTTGGATCCCGAGCTTGTTCCGAAGCACACCGAACTGCGTTGCAGGAATTG
GCTTCGTCATGATGTCCGCCAGCATGTCCGTTGTCGACACATACTGCAGTACCACTTGGCCGTCTTCCACCT