Description :
From Genome Similarity Track
Location :
contig_38:64744- 94988
Transcript NameFunction/comments
g8311.t1POM72399.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora
g8312.t1hypothetical protein
g8313.t1ETI40575.1 hypothetical protein F443_14056 [Phytophthora parasitica P1569
g8314.t1XP_008909548.1 hypothetical protein PPTG_14758 [Phytophthora parasitica INRA-310
g8315.t1ETI40580.1 hypothetical protein F443_14058 [Phytophthora parasitica P1569
g8316.t1hypothetical protein
g8317.t1KUF64454.1 hypothetical protein AM587_10013204 [Phytophthora nicotianae
g8318.t1XP_009519956.1 hypothetical protein PHYSODRAFT_485256 [Phytophthora sojae
g8319.t1ETP10341.1 hypothetical protein F441_13990 [Phytophthora parasitica CJ01A1
g8320.t1hypothetical protein
g8321.t1XP_008909558.1 RuvB-like 1 [Phytophthora parasitica INRA-310

Sequence
30244 bases(100 bases per row)
CGTTCGTGGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGTGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGTCACG
ATATTTGCTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTCCATC
GCAGAATTTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAAAGAGT
ATGATCTAGTAGACACAGTTGGAGACGATAAGGTCCGATAGATGTCCAAGCTTTAATTCAAGACCACATGGCCAACTTAACCGAAGCCGATCCAGGTTTG
TGCTTGAATTATTTGCAAGTAACCAGTTGTGACCAGGATAGTTCAGAGGCACGAAGTGAAGCTACCAGCTCCACGTTTTCGAGGCCAATGAATATTCACG
CGCGACACGAGCTTTGGCGTTGGCATGGACAACTTTGCAGTCGAGTCCGTGGCCGCGGAGGTGGTAAAGATGAACTCGAGCACGCCCGAGTTTCAGAACA
ACAAATTCCACGGGTCGCTCAAGAACACCAAGTTCATCAGCATTCGCTGAGTTGTCGAAGCGGCCTCATCGCCATCAGCAGCAAGATCATTGTCGTTTTC
TCCCTGGTAGAATCTTGCTTTTGGTCAATGTTGCGTTGGCTTAACCACGGTGTAGTAGCGGTCAGCATAACGAGCAGAGGCCCCAACAGATCATCATCCC
AGCTTACGGAAAGACAACTTGGTTCCCAAAGAGCTCCCGCGGCACTGGGAACAGCTGACCGAGCGAAAAACAATGGATCCGGGACTGTATCGCCTTTCGA
CTGTGCTTTCGCCTGAGTGAAGTTTGTTGGTTTGACCCATCGGCGTCGATGCCAACGCGTGAGCCCCCGTACCGTTAAAATGACGAACACATAGATAATT
GCAGCAAGGGCGACGGCCAACATATCGCTGTAAACGCCTTCGAGGTTCATTTTCCACCCATCTAAAGTCTCAGAGCGCAGCAGCATAAAGGTTGGCACTG
GCTCCACCTCATTGGCCTCCAAGATCCTTGCGTCACGGTCGTCGACAGCTATCCCTCCATGTGCTACAAAAGCCACGGCACCGAGTGCTAAAGCGGGTAA
TAGATGACCACGCACACCTGAAACGCCATGCGAAGGAGTCCAGGCACCAGCTGAGGTCTGCAACAGCGCTCGGAACCGTGCCAGCAGCGCCATAAGCCAA
ATACATCGCATATGGACAGCCAACCAGCGCGTTAGTGCTGAAAAACTCTCCGTCGCGCTTTCTCCACCGTCATCTTCCAGTTCGTAAAGTATCAAGGCGT
CGATAATATGTGCACTGCGTAGCAGACTACGGGTAACCAACTGCCATACACCACAACTTGGCTGGGGATAGCAAAGAAGACACGTAGAGCGTGCTTCATT
CTTGACGTATCCGTGCCGTCTTCTGACCAACATTTTTGTCGACAACGGCAAAACAGGCGACAAGCAGACACACCACTCGCACGACGACGTACAGTTGCCC
GATAAACGCAGTGTTGATGCCAAAGAGCTCCATTCGAGGGCGTCAGTGTAGAGGACTTTGCCCTCGACACGCTCATCAAAAACCGCTATCGTCTTACAGA
CACGTGCGTCAGTGCATTGTCGAATCCGGTAGAGTGCCACAACATTGTAAATCTTGTGAGCAATCAAAACAGCCCCACCCAATCTTGTCAACGGGTCCGA
TTCAGCCTCAACTAGCGTGACATCGAGCTTTTCACCATGTGCTAGTGTTGCTTGTAATGCTGCAGCACGCGATGACACAATCTCCCATAGTGCTTCGCTT
TCGGTATCGTCGACGGGTAGAGCAGCAGCCCACGGTTTCTCGCAAAAGAGCGGCCGATCCAAGTCGTCCACGCACAAGTCGACTCCAGGATTTTTGGTGT
CGAGATCGGTGAACGTTGTAACCCAAACGCTGAGCCAATACTTATGATCCAGCAAGTTGCGTGACAGAAAGCTGGTGCTGCTACTCGCAGCAGTGGAACC
AGAACCCGCGCTACTCGTACCGGTCCAGCGAGCTTTAGCACGAGCTGAGAAGCACACGCGTTGGGGCAGCGAACTTAGTTCGCCTCGTGCCATGATCGCG
ATGCCTTCTTCTGTTTGAGCCACATTCTTGTAGCTTGTAGTGCTTGGAGCATTGGCCGCCACCGCCTCGACAAGGGTATCGAGCATGTTGAACACTGTTA
CTGCAGGCAGGGAATCGCCACAGTCGCTACTGTACGACGCGCCCACGGAATGAGCGCTTAGTAGGCACGTCGGCCAGGATGAATCCAGCATTGGGGACCC
CTCCAGCAGATCACGAACGGTGCGTAGTCCGTAGGAGCTTGGAGTGAACTTGTAGAGCGCAGTGGATACCTTTGAGCTGCTGGCCGAGACTCCGTCTGTG
GCCACCGTGCCATTTTGAAAGAGCGTTTGACTTGGTAGTGCCGTGGGTCCGTACACCGTGAAGACATTTGGCTCGATCTGAACAAACGGAAGCGACGTCA
CGCTCGATCCCGCACGTGGCACATCGGAAACGAGCAGCGCGTACGCGAAGAGAGCCAGGATCACTCGGAGAGCGGTGGATCGAGGCAGTCCCTCGACGAA
GGTAGCCGTCTCGCGTGCACCGTCCGGATGCATCGCGTGCAGCAGCAGCGACGAGCGTTTGCGCTGCCAATTGTTTTCGGTTGGTACAGCAGAGGCCGAC
GGCGCTCCGGATGGCTGGGCACCAGGTCCGGCGGGTGTCTTAGCTCGAGTGTCGCTGTTGAAATCCGGATTCGCCTCGACGTCCTCAGTTTGGTCGTGCG
GCGACATGCGATTCTTGGACTGGTGCGGAGACTCGAGAGCACTGCCGATGCCCCCATCGCTAGTGGCCATGACAGCGGATCCGAAGCTGCAAGTATTGGG
AATGCCGACTGTTGCCCCTACTGCTGGATGGTCGGCGGTTTCGACAAAAGATGCCAGCATCGCTTGTAATGTATGGCCATGTTTCTGCTGCAGGAGTCGG
CATGAGGCCTGGCCCTTGATGTGAAGCTACTGCTGGAGACGGTTGTACCAAGTCACAATGGACTCGAGCCCCGAAGGGCTTTTCGTCCGACATGGCTACA
TCTCGAGACACTGTGTCCACGTATTTAGTGCAGTAGCGGATACACATGTACTTTGCCACCCACCACTTCCTTGCTGAGTCACCCACTTCCAGCGGAGTCT
CCAAGTTGGCGTCTCCGAGCTTTATCGGTTGCATGGCCTCCATGGTTAATGCCCCATAGTGACCGCATCTCCGCTTCTCGCTTGAAGCTTACGCCACGCC
TCCAATAGCCAAGTGCACCATTGCATCATGAAAATCCATCGCAGCGTGTGACTTGCAGCGGCCATGTGGGCGCGGTATGGGTTCATTTTCGTCCAATCAT
GTCCCGAAATCGCGTCCCAGAGCCGGCATCTGCCCAGCCACTTCATTCCCGGACTTGCCATCGCTCGACCAACTTGCCGCCCGCCATGAGCATCGACTGG
TCACTTGAGTGCTGCAACGACAAGCAGTTCCTGTCCATCTTCCTCATCATCTGCTACGCCGTCGCCATCTTCAAACTGTGCGGCCATCGATAGGTGCTCC
ACCGAGCTGTTTCATAGTCTTCTAACCTCCTTCTCTTTCTCCCAGATGGCGCGTATCAATCCTCCACCCGTTTAAAATCCTGTACGTAGCCATTGCTGCC
GACGATTTGAGGGTTTCCTTATAGCTGACTGGGTTGTCGTGGCTGCAGAACGGTCTTCCTGCACGAATTGGGGCATGCGACGGCTGCGTGGCTCACTTGC
GGCAGCGTACGAGACCCCCGACCTAGTATGATATGAAACAATTGACCTGATGCGACTATTGCCGCTTTGCCCATAGGTTAAAGGAATGGAGGTGCACCCG
GACGAGGGCGGTGTGACCAAGACTGTCGGCGGACTGCAGTGGGTCATCCTCCCAGCTGTACGTCGCTGTGGGGAAATTGTGCTTTTGGCAATGTACTGAC
GTCGTCAATTGGTGGCAGGGGTACCTGGGATCGGCAGTGTGGGGCATGGCGCTGATGATTGCGAGCGCTGACAAGACTGCGTCGGAGGTGGCAGCGGGCG
TCCTCGTCTTCTTCCTGCTCATCTTCATCTTCTACGCGCACAACGGCTACCTGAGGATCCTAAATTTCTGCTTCATCCTGCTGCTCGCGGGCTTGCTGGC
ACTCAACATTTGGACGACTTTCGACGCGCTGCAGTACGTGACGCTTTTCCTGGGCGTCATGAGCTGCCTCTTCTCCGTGTACGACATTTGGGACGACCTC
ATTTCGCGACGAGTGAACGAGAGCGACGCGTCTGTCTTTGCCAAGATGACTCATACGTCGAGTCGCTGCTGGGGGGTTATCTGGGGCATTATCGCGCTCG
TCTCGCTCGTCGCTGCCGTTTATTTCAATTTGCTGGTTGCACAGGACTCTGGCGAGTCGATTACGAACATCTCCGACGCCTCCACAGGCACGAAGATCGC
CCTTGCCTGCGCCGTTATCATCGTGGCCCTCGCCGTGCTGCACACTGGATTCACGCGGAGATGTATGCTGCGCAAGCGTGAAGGGTTCAGGGGCTACTTC
TCCGCTTAGATATTATCGTGGCGATGCCAGTACTCGAGTGCCTTCATTATCCGGTACTGGGGTGCGTTTTACGCGGTGGAACTTGGGCCAAATGATATTT
CTTCGTCTCCGTTGTAGATTTCTTTCCTGTGTCGTTATCACTCTTTACTGATGGCGCTGGAAACCAGGCCACACTTCTCTACGATATCTACCAATACACT
GTACCTACCAACTCACTGCGAGCACGTTCTAAATGCTTAAGGCGTCATCCTCAAAATCTCTTTGTTCGGGTTTGTCTTGCTGCCTTCTTGCCATCTCTAT
GGAAGGATGCCGTTGGTCATGCGCTGGAAATTGTCGTATTGACGAGTGCTATAGTTGTTGTTGCTCTTGCGGATAAGTGATAGCACGTGCGCCACAGTTT
CTTGCTTGGATAACGACAGCTTGAAGCGTGAGCGCAGGCGCAATAAAATATAATCAGCGTCGATGCCCAAGAAGCACGGGTATGGCGACTGACGTGACAT
AACATCCACGAGGTCACAGATCTCGTCACAGTGCTGTTGGCACGCCAGGAAACCCCGCGTGCAGAGCGTAACATACTCCTTGAAGCCTTCGGAGTCTTGG
CCACCCATAGTCTCTACCATTTCGGCCGTCAGTTTGAACGGCGCCGTCTCGATGCTAAGCATTCCACCCGGAGCGATACCAAGCAAGAAACCGTAGTCGA
TATGGATAATATGGCCTTCGTTGTCCAGCATGATGTTGCCATTATGCCGATCCTTGATTTGAAGGAAGTAGCACACAATCGAGTATCCTGCCATGGACTG
GATGTATTTCCGTTGTGCTTCCTTGAATCGATGTGAATCCGGCGGTCCGTAGGACTTTTCAAAGTGATGAAGCAGAGAGACATACCCTTCACGCTTCTTC
AGACCATCCAGAGAAATAGCGTTGATGAGGGTCTCAATCAGCCCCGTGGACGAGCTCGTAGCGATGATGCGGTACCTCTTCACCCACATAGGCAGATTTG
CTCCCCTGAAAATCTCGACAAACTTCTGAATCAACTGCAGAGTAAACACCTCCTGTCGAAGATCGTCATTACTCTTGCCAATCATTGACACGATATCCCA
CCCAGGTAGGTGCCCGTAAGGTGATGCGGCACACAGCCTTGTTCGTTTGGAGCTCCACGATTCGCCAAAGGCCGCCTCGAAGTCTCTGCGGCGGGCCTTT
TCACGCTCCACGGCCTCTGCAGTCAAATCACCCGTAGCCAAGTCCATTTCCAGTGGTGCTGTCGGCGCACCATCGGTTGTCGTTCCACTATCCACGGTAG
CGCCCACGTATTTTCAATTAGTATCGGAGGCGCCGTTGAAGGTGTAGAACAAATATCGGGAACATCAATAGGCGTCTCAGGAACTGGGGCCCGGCGAACT
GCAGCGACTGGTGTTTGATATGGTTCTGGAGCGATAGGAGGAGGAATTATAGTCTCAGCTTGGATTTCCTCCACATCATCAGCTTCTCCAGCAAAAGCTT
CACTGGCTTGGTGACCAATCAGCTGACCAATCTCATCGTCCTCGACGTAGTTGACCTCAGAAGATTCCAGCGCACCGTTTCCGTTCATATTCTGCCTTGA
GGGAGACCGCGGTGATTCGGGAAGCGAGGTATCTTGCTGTTGGTCGTCGGTGAACGGGTTGCCACGAATTACCTCGAAGATCAGCAAAATAGGAACGCGA
GCTTCGTCGAGAAAGCGGTGCCTTCCTTGGTAGGTATCCGTACAATACGTTCGAATGGGTCTGTTGCCTTTACCAACGGCACATACGCCATGGGAGGGAG
ATGCAGTTTCTCCAAATACGATGGGAGTTGTTGTTTTCGATCCTGAATGGACGGCACGAAGCGCAGAGCCTCAGCAATGTCAGTGATTTGCTCCACAAAA
TCACATTCGTCAGCGAAATGTTTTGCCAACAAGTGCTTATCCGTTTGGCTCATTCGACGCATAGACTCACTGAAGATGCTGGTTGGCTGGTTATCGGTGT
CCTCTTCCTCAAGAACCGACAATCGTTCATCTTGTTCATAGTCGTTATCTGTAGGATGCGAGATCAGCATAGAATCAAGGTCTTCCTTGGGTGTCAACAA
ATGCTGTTGGAAGCGCGAAAAATCACGGAATCGACTATCGACATCAGCATCCGACCCGCTGCGATCGGTGCCATTCCTAGCCAATGGCGGGGACAATGGT
GGGTATGGATTCATAGCTGCAGGAGAGCCATTGGCGAGAGCGCTGCTTGCGCGAGACGACGGTGGGTCGCAATCTCCTCTGTCAATTTAACGATAACTTG
CAGCTGATCATCTGTGGGATTCGGCAGATTACGCTTGTGCCCCTGGGCTGTCTCCTGCTGCGGATCGCGACTGAGCACGGTTGCACGGTCTACACCGGCA
ACCTCGCGCTCAATCTCGACCATCAATCGCACCACACGTGGGTATTTATCCTGCATGTCCTTGGGTTTCCTCGGATCAAAAGAGTCCTCCAGCGCGCCTT
GTAGTTGCCAGCGAAGAAGAAGAGCTAGGTGGATAGATCGCGAGCACACCGACAGGATGAGCTCGTCAGCCAGAAAATCTTTTCAAAGTCAAAGTTCGGA
ATCGATAGGTACGCGTGCACGATCTGCGGCCAGTAGAATTCCACTTGGTTGATACGCGTGTACGAAAAATGCAACAGCTTCTCCACGATAGGCTTAAACA
ACAGAGGGTCACTGTCCAAATAGCGATGCAGCAGAATCACAGCACGATAGACGCTAAAGCTGCGCACACGGAACTCGCGGTGTAGACCTAAGATTTTCAG
GTCTAGAGGTATCTCTGGATGGTCCATGGTGTGATCATAAAAGCGTCGATCCTTCAGCAAGATCTCTTCACATTCTTCAGCAGTAATTACCTTTGCTTTG
AGCAAGTCAATAGCAATCTTTGCAGACTCAGTCTGCAGCGGACGCTTCGGCATGATGAGCTCAATCGGAGCCTCTGGATTCAACGGACGCGGATACAAGC
AAATACCAGCCTTCAGTCGCTCCATCATCGCACGCAAATAGTTAATGTAATTCTGTGCCTCATAGCAACGGTCACACACTCGCTTGGCGTAGTAGTGCGA
CCTCTGCGGGAGCGGCACTTTGTGCGTCGTAAACTTGTCACAAAACAGTCCATCACAACTGTTACATTTGTACAGCAACGCAGCAGCAGTCGGGGCCAAT
TGCCCCGCAGAAGCAGCCTCTGCTACCAACTGCGTGCAGTCCGGACACTTGCACGTCACATCTGTCTCACTCGATGGCACCGTCACGGTGCTCACGGGCG
AGATCGACACATCCAGCGTCGCGTGCTGAAAAAAAGCTGCTGTAAGGCGAGGCACCGTGGTCTCCACTGACGTCTGGATGGCACGGATCCATTTCTCTTT
GTCCATGGCCGTGTCCGCGTAGGCGTAGAAGACCTTATTCTGCGCCGTGGCAAACAGGAAGCCGTGCTGGTAGATGTGCATGTTGCCTTTGCCGTCCCAC
TCCTGCACCCCCAAAACGTCCGCTTCGCCCTTGAGCCGCAGCATGTGATACGCGTCCTCCTGCGTGCTGCTCGCATCACAAACCCAAAGCAATTAGTACC
AGGAGTCAGACTAGTGCCAGAATACAAATCATATACTGTACCTATAGTATTGGAAGGAAGTGCCCACGAGGAAGCAGTAGCGCCGCAGCATGGGCGGGGG
TGACGACGGACTCGTGCGGAAGGTCAGGTAGCCCTCACAGCTGGCGCGCGGGGCCTTCATGGAGCTCCACGAGATCAGACGCGGTCTAATACGACGGCGG
CGTCTCGTGGTGCTGCTGAGTGTTGATGTGCGCTCGCAACGGGGCGCGCAATGCCGATCTGCGCGTGGACTTGGGCGACGGCTGATTACTCACCTCCGAC
GCACCCAATACACACGATCAACGGATCACCGGACAGAGCAGACGGCGGGGGGCACGAAGAGTCTGAAGCGGACGGCCACGCGACGCTAGGGACGCGTATG
GGGAGAGGGAGCGCGGGCCGAGAGCGCGCGAGCCTTCTCTCTTCAAGTGGGCGTTGCGGTGTTGCGTGGGAGGGGGGAAGAGCGACCCGCGTTATAGTGG
CGTGTCACAATCATGCGGGAATGGTACCATGAGTATGGTACACTCGGTTTTGCTGGTTGCGAGCCCACCAGCAATTCGTGCATCAACGCATTCGCGACTG
TAGTAGACCGATGGCTCGCGGGAAAAAGACGTTGGCGGCACCGCTGAAGGCGTCCACGCCCAGCGTCAATGGCGGCAGCAAAAGCAGCAAAAAGACGGCC
GGCGTGGCGCAGAAGAAGCAGAGCAAGCAGGTGAAGCCTTCCCCAAAGAGCCCCAAGAAGACGGTGAAGGTGGCGGTGAAGGCGGATGAAGCAAGCGAGG
GAGAGGAAGAAGACGAAGAGGCCAGCGATACTGAGAACAGCGACGACGCTGATGACGAGGAGGATGACGAGTTCGAGGACCAGGGATCGTCGTCGGACGA
TGACAGCGGCGACGAGGAAGAGGACGACGCGACCTCACGGAGCTGGAAAAGAAGACGCGGCGCTTCACTGTGGACCGCGAAAACGAAGTGCAGAAGATGC
GTGAGGACGGGTCGCTCCAATTGGCATCGCAGTTGCACGTGGACGACCTGTCGTCTGATGACGAGGTGGCTGCCAATGCTTGATGCATGTGTTGCGACGT
GTGAACTTATCCTTTGGTTGTGCTTTTGCAATGATAGGAAAATGTCAACACTATTGGTAACGTGCCACTTCGGTGGTACGAGGATTACGACCACATTGGT
TACAATGTGGACGGCAAGAAGATCATGAAGTCGAACAATGGCGACGGCATTGACAACGCGATTGCCGCGAAGGATGACCCGAACTACGAGTAAGTGACAT
CGAAGCCGTAGGATTCCTCTTACCTGCAGACGTCTGACTGTGTGTTTGTCCTTCTTGACAGCCGCACCGTGTACGACGCTTACAACGACCGTAAGATTGT
CATTTCGGAACGTGACATGGAAATCATTCGTCGTATGCAGGCGGGTGCATTTGCACACCCGGAGTTCGAGGCTTACCCGGACTATGTGGACATTTACTCG
TCGAACAAGATGATCCACTCCATGGGCAACGAAGTTGAACCCAAGAGCCGTTTCTTGCCTTCAAAGTGGGAGCGCATGAAGGTCATGAAGATCATGAAGG
GCATCAAGGAAGGTCGCATCAAAATCGATGAGGAGCCAGAGAAGAAGCCCGATGTATACCAGATGTGGTTCGATGATGACCAGGCGCAGACTCGGAAGGG
TCCTGCTCACGTACAGGCTCCGAAAATGCCGCTGCCCGGACACATTGAGTCGTACAATCCTCCTGATGAGTATCTGTTTACTAAGGAGGAGCGTCGAGCT
TGGGAGGAGGCCGAGCCGGAGGACCGCGAAACCAACTTCATGCCGAAGAAGTTCAAGTCGCTGCGTGAAGTGTGCGGTTACAATGGCTTCGTGCGTGAGC
GCTTTGAGCGTTGTCTGGACCTGCACTTGGCGCCGCGTGTGAACAAGCGTAAGCTTAACATCGACCCCGAGTCGCTTGTGCCGGAACTGCCGAAGCCTCA
GGACTTGCGTCCTTTCCCAAACACACTGGCGCTTGTTTTCAATGGCCACACTGGTCGTATCCGATCGCTGGCTGTGGACCCGTACGGCCAGTACGTGGCC
TCGGGCTCGGACGATTTCACTGTGCGCATCTGGGAGATCGAGACTGCGCGTTGCCTGCAGGTGTACAACGTTGGTGCCGTGGTGCACAAGCTGTCATGGA
ACCCGAACAAAGACCACCAGTTGCTGGCTGTCGCGGCTGCTAAGAAGGTCTTCATTATCGCTACCGGAACGGGTAGCGCGGATCAGACGGAGCTTACCAA
TGCCCTCGTGGGCGACGCCGACGAAAGCATTCAAACGTCCTCCGAGAAGGATGACAAGACAGATAACGCCGATGGCGACGTCCAAGTCGTTGATGAGGAT
GAGGCCACCGTAGAGGCTGACGCGCTTAAGAAGAAGGTGCCTGTGACTTGGCGATTCTACAGTGGCACGAAGGACAAGCACAAGTCAAAGAAGGCTGCAG
AGCGACCGTGGCTTGAGCGCCGCGTGGGTACTGGTATTCGTGTGGTGCTGCACCACACGAGCGACGTGAAGGACGTGGCCTGGCACCACAAGGGTGACTA
CCTCTCGACGGTTGCCCCTGGCGCCGGCTCCGGAGCGGTGCTAATCCACCAGCTCTCAAAGCGCAAGACTCAGAACCCGTTCCAGAAGAGCGTGGGCCAG
GTGCAGTGCGTGCTGTTCCACCCGTCCAAGCCGTTCTTCTTCCACGCCACCCAGCGCCATGTGCGCGTGTACAACCTTGTGAAGCAGTCGATCGTGAAGA
AGCTATCCTCCGGCGTCAAGTGGATCTCGAGTATGGCCGTGCACCCGAACGGAGACCACCTGCTTGTGGGTAGTTACGACCGGCGGTTGTGCTGGTTCGA
CCTGGACCTGTCCTCGAGGCCGTTCAAGACGCTCAAGTACCACGAGAAGGCTGTGCGCGACGTGTCGTTCCACGGCAAGTACCCGCTCATGGCTTCTGCC
TCGGATGACGGCACCATTCACATCTTCCACGCCATGGTCTATTCGTACGTATTGCTTGGCTCTTGCATTTTCACAAGTGGCTTCTGAGGCGAGCCAGAAG
CGATTAATTGAGGTGCCTAACTGCTAACTCATGTCGTGGCGTGATCTCTGCAGGGACCTGATGAAGAACCCGCTGATCGTGCCGCTCAAGATCCTGCGTG
GCCACGAGGTCTCCGGCGGCCTTGGCGTCATGGCGCTGGCCTTCCACCCCGTCCTGGTACGTTCCTTCTGCCGCTCAAGCAACGTCACGCCATTACTACC
GATCTAACTCTTGTTGCAATTTGTGTTGATTCGCTCAGCCGTGGGTGGTGACAGGCGGCGCGGACGGTTCCATCCGCCTCTTCCAGAACATTCACTAACT
CGCCCGTTGCAGCGACCGATGAATCCGAGCAACCGTCCACAAGACGTCGGTAGCGGTGCGCTTCTGCAGCTTTCGAAGGAGGAAATGCGCGCTGCCGTCT
CGGCGTGGGCAGCTAGCAACTGTGACGATTTCAACTAATAGACAATGTGCCTTTGAAACCTCAATGCTCGATGCCATAGAGACGACGATCGTTTGTGCCT
CCGTTTTGAGCTGCCGGTAAGCGGTAAGGCTCAGGCGAACAGCAAATTGCGCCAGGCTCATGATGACGGCACACCTCGCCTTTCCTAAGCTGAAAGCCAG
TGCACTGACGCCGCTGCAATGCTACAGCAGCATGGACACTTTGGTAGCATGACATGTGAAGTCCTTAATTTATTTATCATGTAAAGGAAGAGGAAGAGTA
CGCGACAGTCTCAGTCAAGCTAAGCTACTCGGTCCAAGCGGATGGAACAGTCCTCCCTCCATCTGCACGCATCAGAATACACCACCACGGGGCTCTACTC
GCCGGGAGAAAGAGACCACAATACTTGATCATCGTCGTCCGCCCGCTTGTCCCTTTTCTCGGCGAGGCTGCACGCAACTTCCAGAGAGCCACGCGTCCGT
CCTAGTTCTTCTTGCCCATGCCCGGGATTCGGAACCGTGAGCGCTTAGGAGCTGCTGCAGGCATCGGCGGCGGCATCTGGCCGTATCGCACGGGGTACTG
GTACTGGCCGCCTAGGGTCGTGGCCGGGTATTGCTGCTGCTGTTGGGGCTGACCATACTGCTGCTGTTGTCCATATTGCTGCTGCTGGGGCTGACCATAC
TGCTGCTGCTGGCCGTACTGCTGCTGAGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGTGGCTGGTTGTTGC
CGTAGCCGTATGTCGGTTGTTGTTGTTGCTGCTGCTGTTGACCGTACGTCGAGTTCTGCGGCGGGTACGTACCCGTGGCCATAACCGGCGGGTAGCCGGC
GTTGTTCATGGGGTTGGGGCGGTTCTCCTCGTCCGAGTTGCGCTGGTTGGCGTTGGAACCCCCGCGCTTGTTGTTCATGGCGTAGAGCGAGCCCTCTGTG
GGCTCGCCGTCGCCGTCCAGCAGGCTGGCGCCGTCCACTTTGCCCTTGCGGTCCAGCACCGTGTCGCCTGAGAGCACCGCGCGGTCCGACTTCTTCTTGC
GCAGGAATCCCACCATGGTGAGAATAAGGAGGGCAGGTGGACGGTTGCGTGTGTAGATAGCAGAGCGAGGGGGCCGCTGCTGCTGAGTACCGAGAGCTTC
CTTGCGGGGACCGGGACGATTCAAGTATGGCAACGCGCGTGCGTTTGGCTTCGAGTGACCAGCCGGAAACTGCGCCCCCCTGCCGCTCCTCTTCTATGCT
GAAGAGATTTGTCGCAATTTTGTGGAAATGCGGCACTGGGCGTTTGTATGGAATTTCACGTCAGCGCGAAAAGGCGCCAGCCCAGAGGCCCACTGCGGCT
CACCTAGTCTCGAACTCCACAGCCAAATCCACGTGGACGCACACGAGCGAGAAAGCTTGCTGACAGATGGCCACCAGACTGGGAGTGACTATGCCGGCCT
GTCGTACGGTTGTGTCGCTCTACAACGAGGGCTAACAAGCCGAGTCTGTGCGTAAACCGCAGCGGCAGACTGCAACTTGTCGTGCAATGGGTTTACGACT
CGCAGCAGGGCATGTACCTGTCCGTCGCTGGGAGAGCTCCGAATTACTGCTACGTGCACTGCAGCTTTCCACGAAAGCAGACCATCTGACAACACACCGT
TGCCAGCTCGCAAGCCGAAAACAGCGGTTTAAGACGAGGGTTTCAGCTGCGGACAGCGGAGACCCACGACGACGACGAGATGGCGAAGCCAAGCCAAGAT
ATTGCATCCGAGGGTTCGTTCTGTCGGCTGTCGCCGCGCTTAGCTCAACTTGCCTGGGCGTAGCACCGCGTCAACACGGTTGCGTCCGTTTCCACCGCTG
CGCTAGTGCGAAATTCAAGTTTCAATTTTTAAGTTGCAGTGTCATCGCAGTGGTATCTTACGTATCCAACGCGACTTTTTGAGGCTGAGACATGTGCAAC
AAAATGGCGAGTAATTGCAGCGAGACCAAGCACCACAGCCTCGCTGGCAGCAAGTTGCTGCTCGCTACGCTCGGCCTAGTCGTCGTCGCCTGCTATGACC
AAAGAGCTTCACGTCCCGGGACGTCTGTGGTTCACGACGCTCAGCCCAGTCGATGATGCTTGACCGATCACATCCTTCAGACGCGGACTCGCTGTCTGTC
TGTACGTCACCGCAATGACCGCCCGAGGACAACTTCAACCACACAGCCTCACAACGACGGCAGCCAGCCCGTGCAGCCACTTTTCGATCGCCCGCCTTGA
GTCGAGGCTCGACATCCCAGAAGAGCTCTCTCGCCGAGTGCGTGGCCTGAATGAGTCTCTACACCAGCACGTAACCAGACCAGCCAGCACCAACGTTGGC
TTCGTACTACCTCCACGTGTCCAACGTGCGACCGAGCGTTGCATCGAGCAGCTGTGCGGCCTGGGCAACGGGCTGCACAATGGCCTGCATTGACGGTGTG
CCTGGACTTGCACGGCAAGATGCAGTGAATCTGGCCCTGCGGCATTTCTATCAACAGAAGGAACAGCAAAGTCCGCGAGGGTTGGACGTAAGTCAACAAC
CAAGTTCTTCACTCATTACCGGTCCTGTAACGAGTTGATATCAACACACTTGGTAAGAGCATTAGTGTATTAGCACGCTACACGACCATCTCAGTCAGGT
TGGCGTGGTGACTGTTTGTGAGGGTGTCTCTGTGTAATGGTGGTTCCAGTGGCGACCGGGAATCTGTACTGCTATGCTGCGGGTTAGTGTCTTCACCACG
TCACGTGTTTGTCGAGGAAATCCCGTGTCATCTCCTCGTTCTGCGCTATGTTCTCCATGTAGGTATCATAGGACATGTGCCACGGATCCGGCACGTCTCG
CGTGAAGACGGCGAGCACGCTATCTCGCTCTGTGATCTTCGGGAACTTCTCCGTGACCTTGAAGGCCATCCCGCTCGCCACGCACACCACGTAGTCGGCG
TTCATGCACATTTCCTCTGTCAGCAGCCGCGAGCGGTGAGCCGACAGGTCCAACTCGTACTTCTTCATCACGTCCACCGCGAACTTGGACGCGGGCGAGC
CCTCGCGGTCGAACACGTCCGTTAAACTGCACGGCGAAAACAACCATCAGCAATTTCGGCAGCCTCCGCAAGTTCCTAACAGCGAGGTTCGCACGTACGC
TGCCGACCGGATGACAATGCCCTTCTCTTCCTGCTGCTCGCGCGACATGTTGAGCTTGCGCCGGAAGTACTCGACAGCGAAGAGCTCCGACACTGGCGAG
CGACACGTGTTGCTTGTGCACACGAACACGATGTTCATGGTCTCTTGGCGTGTGCGGTGCGGACACAATTCTGATGTGGAGAGCTTGCTGCGACCCGCCG
CCCAATGGTTACAAAGACTCCACAGCCAGCAGTAAACGAACGGGGCTGGAGGTGACAATTTCGTTCCCGCTCGCCTTGTTGGCGTCGCCGACTTCAAGCG
CGATGGCCGTCGCATGCGTGCGGAGTAGATTTGCAGCAGATTTCCAGGCGACCGCCTGAAAGCTTTCGACCGGCATGAGCGACAAGCAATATATCTACAT
GCACGAGCAAATGCACACGAATATGCACAATTTGGTGGCGAATTTGCCACACGGGAACTATATTTGAAATGCCACGAATGTGCTTCCAACGTATCCAATG
CAACCGCAGCTAGTTTACTGGAAGCGCTGAACGACCTTCGCGTATGGGAATGGTCCCAAAAACTCGCTGTGGTTTTGCTTCTTGGTAGACGCCTTGAGCA
ACGAATAGTCGAGTTCCGTGTGCAAGTCTTTGTTGGCAGCGTACGACTGTGGATCCCACTGGATGTCGAAGCTGTTGACGAAGAAGCCCTGGAATTGTGC
GATCCATTGACGCAACGCCATGTACGGGATGAAGTAGAAGCCGCACCGGTCAGTGTCGTTCTCCTTCACCTCCTCATCAACGGGTGCCAGAGTAAGCGCG
ATGTAGACCTCTAGCATTGGAGGCAGGCACATCTCGCGTGCCACATGCTGCTCTGCCGAGTACTCCCACAGGCACATGACAGTCATGCGGTCGCCCCAGT
CCGTCGTGTTGCGAACGAAGTAGGTGAAGTCGCTATCCGTACGACATAGCTCTGAGTCCTTGCACTTCAGATGTAGTGGCTGAATATTGACGTCTGCGAA
CACTTTTGTCTCGTCCGAGAGGCAGTCTTCGATACCTTCATTATACTCCAGGGTGTTGTTCGCTTGCTGCTTGAACGAAATGCCTTCATTGCCGCACTGG
TACCAGTTGAACGGGCTAGATAAATGTACCAAACAGAAACAGTTAGTTAGTCATTTTACAGAGTAACCATGCTTCGCAACGTACTTGTAGCTGTTGGGGC
AAACCGAACGCTCTTCCCAATCCGAAACCTCCTGCATCCAGTATGCGAGAGAGTGACTGCCTTGATAGGGCCCATCCGCCCAGGAGTTCTTCACGATAAG
TCCGCCAGTGAAGCCTTCGCGAGTAAGGAAGGCGTCATTGTAGCCTACAAGAAGCTGCCAACACAATTGCAAAAAAACCCGGGTAAATGACGTAGTCGTC
ACACAAATCTGACAAATAACTTACCATGGCGTGACCACCCTCGATTGACATGCCACGGTGGCTAAAGAATTCGCCTTCCATGTTGCGGTTTCGACCTCCC
TTCAAAGGAATGCAGCACGTCGTAGTAGCCATATCTCCTGGACACAGCGTACACGTTTCCGGCTGGCAGTGGCGATCATTCGAGAACGCGCCAATGCACG
GGTAATAGTGAGTGACCATGGCGATCGGAGTGGAGAGAGGCATTGCTTGATTTTTGCGGACAAGGTGCTCCCTCACGGACATGTCTTCATACTTGGTCGT
CATGCTCTACAATATCGAAATCGAAACAAAACACAGTGTTAGCCAACCTAATTTCCGATGTGATTCTTGACCGAGTCTCTTCGCTTACAGAAAGCTCGAA
CTTGAGCGGATTCCCAGCCGTTTGGGCGGCCTGGAGACCTGGACAAAGCATGTCGTTGCCGTCTTCGGCGTAGTATTCGCAGACAGATTGCGGGAATACA
GACTCTTTGAGACCATTTTGTAGGTAATAAAGTTCCGGTACCTCTCCCCCCTCTGTCGAGTTCATCCACATCTGTATATAGCAACGTCAGCATTTGACAA
TAGTTCCAAACAATAGAATATGGCTGACCTCGTCACCCGCCACTCGGCAATCCTTTTGCTGCTGTGAGTCTGCATCACCGGTGCAAAGCTGGAGGATCTC
CACGCCGTACGCCTGCAAATAACCACATCAATAATAAACACCGATGTTCTGCTACAACTTCACTGAAGGATATTAGTCCAACGTACCTGCTCAGAAAATG
CAACATACTCATTAGGTTTGAGCCAGCCTTTGCGGACACCGTGTGCGCGATACGACTGCTCTAGGAACCCGATCGTCGCAAAGTCCCAGCACGTGCCACG
ATAAGCCTGATCCTGGCGCGGAGTCACGAAGTCCACCGCGAACTTGGATGGCAGCAACGCCATCGGGATCAAACCATTTTTGGAGACGAAGCTCATGGCC
ACCGGGTCGAAGTCCTCATGAGCAGCATTCGGCGCATCTTGGCGGGCTTCGCTGGCAGTCTCCCTGCAACAGCATTAGGTCAGTAATGATAACAGCCAAA
CGTTAACAACTCTTCAGATCTTTGCAAGGCACATACCGGTACATGCTGCTGCCAGCCTGAGTTTCCAGACGCGAAATCGTGTTGTTCATTGAGATACATA
GGAACAGGAGCACGAAAAGCGCGACGCCGTTCACCGCATAGAAGACCGTCCGCAAAGGAAGGCGGGGCAGTGCACCGCGCTTATCAGCAACAGTGAGCTG
TTGCGAGTGGACGGGCAATTCATCTCTGTCGTTGTTAGCTGGGTACAAGCACCATAACGCATTCGCAGACATCGTTAGCGTGCGATAAACAAACTCGCCT
CTGGGCTCTAATCGTACCTCTCCCGGAGCCGTAGCGTAGCAGAGGACTGCGGTCTCTAGCGGAGACCGACCTCACCATTCGTCTTGCGGTGAAGGAGACG
CGTTGAAGAATGACGTCTAGCAGCCGATCGGATTTCTGATCGGCAAGTACATCCGAAATATGCTTACCGTGTGCAAACGGACCAGCGAAGGACGCCATTT
CTATCCAATCATATTCCATATTTTTCAAATTAGAAACGTTTGATTGGTTGTTTATGAGGTGTCCGTAAATGGCGAACGTCCGTTTATACACAAGGTTCGC
GGTATTTGTATCAAAAATGACTTCACTTCACTAAAGGAGAGCTGTCTGCAAAACGAGACCTGTAGCTCAAGTTGACCGTCGTGACTGTGAGAATGCTATA
CCTATAGATATTAACATAGTTTTTCCTTCAAAACTGTCATCGCAGACTACTGTGCATCTACTCTTTGCAGCCATCGCCACCGGCGATCACGAGACACGCG
GTAGAATCGAAAATGCTCATGAGGTTGGTCATGACGGACCAAATGAGCGAGAGCGACAGATACGCCACCGTGACAAACCCCATGAAGTAGCTAGAGCCTC
CCAGACGCTTCATCATTTGGGTTTGTTCCTTCTGTCGGGGAAGCATCACCAGGAACGCGAGCGAGAACAAGTTGGCCGCCCACATGATAAGTACCGTAAT
GGTAACGTCGTGCCTTACTCCTTGGGAGTCGTTCTGGATCCGCTCCGTTGTCAGGTCGAATTGACCATTGACATTGCGGGTGATCGCAGTTGCAAAAGGC
GTCGAGAGGTTGTAGACCGTCGTGAGCAGACCATACATGGCACCTTCGTGCCCTTCCGTGGACAGCTCGACGATGATGAAGGAGCCCACGATGAAGATGA
TACCTTGTGGAATTTGCTCAAGAATGGGAATTCCCATCCAGATCCATGGCGAACGGACGACATCCCAGATTGTCAGGCTTGCCCACAGCATCCAGACTCA
CGTTGCAAATCATAGTCACGACCGCCGTACGCCGCCAGTCCCAGTCGCGACCGTAGTTGCCGGCAAACCAGACTGCGATGGCAAACACGCCCGTGTTGAT
GAAGCCGGCGATTTTATCTTCGAGCGGCGAAACGTTAGCCCAGGTGGTCTGGATCGGATAACCCGATACGTACGTGAATGACGAGAAAATACCCGAGAAG
AACTGGTAGGCAATGTACTGGTACACGGCCCGTGTCTGTACAACGTCCCAGAGTTCGCACATGTAGTGCTTGAAGCTCTTGCTATCACCCGGGCGCTTCT
CTTCGTAAATAAACATCCACGTGATCGGCACAATCGGCACAAGAGCGACTGCCACGATCAACATCATGATTGGGAACGTGAGCGAGAAGTTAAAATCGCC
ACCGTAGTCCTCGCCGTTGAAGCAAAATGCTACCAGAATGAGAGCGAGGTTGTTGAACACAAAGCGCGTGGTGTAGATCACAGTTTGGGTTCTTCCTCGA
ATTTCGAGCGGCTCGCGCTGCGCCAACTCCACCACAATGCCGTCGGCGCACACATCGGCCATCAGATACCCGAACGCGCAGCCCATCATTGGTATAACGT
AGACGCTGCCATCGTCGGCTGCACCGTAGTTGAGCGTGGCAATGATCTCGGGCGTGTAGTCCTCGGGCTTTATGTCTCGGTACGCTGGGTCGGTGAAGTA
CGGCTCGCCCTGGGGTGTGAGCACCATGACCAAAAGCATGGCTAGAGTGATGATCCAGCCGATGACCATGTACGGTCTACGGCGATAGCCATGGATCGGG
AAGCAGTCAGACACGATGCCGTAGAAGACCTTGAAACTCCAGGGCAGCTGCACAAGCACAGAGGCTGTAGTGGTTTGGGAACCGGGGAGGTTGAGGTAGT
TCTGCAGGAAGGGGTAGATGACGTTGGGCAGCACTCCGTCAATTAATCCAACGGCCGCGTACTGCGCGACAAGGCCGATATACTGCCTCGAAAAAAGTTT
TGGTGCGCCACCGCTCCGGAGCGCGCCGCCTTCGATGTAGTCGTCGTACACGTAGCGCATTTTCCCGTAATGATGCGCGGGTTCCAGCGGCGACATGCTG
CATTGCGAGTCTCCCAGCATCGCGGCCGCGTCAGGGTTGTACAGCTCAATCTGTTCCGGTAGTGGCATTTCGGTCTCCGTAGGCCTGAAATCAGACAGGC
TCATGTGCTGAAGGCTGCGAATCGAAAACTACTGAGCGAGGGGATCTGCTTGCAGGGCAGATAGCATGGATAATCGCAAGTGGTGGACTCACCTCCAGGC
AGATGCAGAGGTCGGGCCGACTTTTCCGCAGGATGTGCAGTGTTAGTGGTTCACCTCGCCATATTGGCCGCCATACTGGTTTGGCATCATCGAAACTTTC
TCATGAACAGAGGACAAAACAGAGGGCACCGAACACACGCAAGAAATGCAAATTCGGTAGGCGACACTATCGATTGCCGCTGTTGTAACGGCGTTATTGC
ATGGACAGTAAGGCTTATTTAGCTACACCTACGCTGCGAAAGAAGGTTCGAGCGGACGAGCAGTGAGATTCCGAGTCGGAGTGCACATGGTAATTCGGCA
AGGGCGTACGTATCCTAGACTCATGCCTGGTTGTAATTTGCTGGTTTGCTGGCTTGATGTAGTACGGTACCGGTGCTGGTATTCATACAGCAAACCACCA
AACGACAACACCGGTGCAGCAAACCATTTGGTCAATCTGTCAACTGAGCTGCTCTCTGCAACTGGAGAGAGCACCTTCAGCTGGCAGGGGGTGCTGACCG
TGACCGACCATAGGGTCCTCGCTAAGCACTACTGAAGTACTTGCACATGCATCATACATGATCTACAGTACACGTAGGGGGTTGCACACATCTTGAGCTA
CCATACCTGGCCTACGGGCTGGAGAAGTCCTGAGGACGACCACTCCAACGGGTGGTCCCATTCCGCCCCACACGGTACTTCAGCCATGGACCGGTACAAG
CTGGCAAGAAGTCATCGACGACTCGCGTACGAGTTGTTGAGGAAGGCCGCGCACAGTACTCGGTGCGAAGAAAAAAGTTTACCGTTCATGCGGTTGTAGA
CCACCCAGCAGACGCAGGAGCACATGGCACGCATGGTAAAACGTGAAGCAGGCTTTTCGATGCCATGACTTGTTGTCGACTGTATTCAACAGAGACCTGG
CATTGAGAATGGCATCGGACGACGCGAACTGGCTTGGCCGGCTCGAGGCAAACGCCAGAGCTTCGTTTCTTGAGCGGTCGGGCTACGGGATACCTTCACG
ATTTGAAAAGCCCGCCAATGTTGCACTGAACTGCTGGATGTACCAAACAGAGAGCCCGTCCGAGTCAAAGTCTCTGCTCGAGACTGTGAGAGAGGAACTC
TGCCAAGGCAGCTGGCAGCCGTCGTCAGTCTCGAGGCTTCCTGCTCGATTTGTAGTTTCCCTGCGCGTTCAAGGTGGTACCCACCAAAGAAGGACGAAAA
CCGGTGGAGGTGTCGTGCCGTGAAGCGAAAACCAGGGCTTGCTCGTTTCCTGTGAGCTTAGATATTGGACGAGAGGCTATCCAGGCCCCGCGTTGGACTG
CGAGGCGTGTGTACACTGTAAAAAATCCGATCTTACCGCATTAGTCAAATTGCGTGGCGAGAGGCACTCTACGACTGGTCTTGGTGGGTCTTGCGGGTCA
ACGGACAGGTACCACCGTCATGAAGGCATCGCGGACTGACACGGTGACATCGCAGCAGGCACCAATCGAGCTGTACAACGAGGACTCGTGCTCGTGGATG
ATCACCGATTCTCCGGACGATGGTTCGCCGTTCCCGATGACGTTCGAGGGCCAAAAGATCCGCTACATCTACGACGACTACATCGAAGGCGGCGCGCTCC
GGAGCGGAGACGCTCCGAATCTGTTCTCGAAGAAGTACATCGGCCTTGTCGCACAGTACGCCGGCGTCGGATTTATTGACGGAGTGCTGCCCAACGTCAT
CTACCCCTTCCTGCAGAACTACCTCAACCTCCCCGGCTCCCAAACTACCACAGCGTTCGTCCTCGTACAGATGCCCTGGAGTTTCAAGGTCTTCTACGGC
ATCGTGTCTGACTGCTTCCCGATTCGTGGTTACCGTCGTCGACCCTACATTCTCGGCGGTTGGGTCTTCGCGTTGACCATGCTTGTGATACTGGCGCTCA
CACCTCAGGGTGAGCGTACTTCACAGACCCAGCGTACCGAGACGTAAAGCCCGAGGACTACACGCCCGAGATCATCGCCACGATCAACTACGACGCAACC
AACGACGGCAGTGTCTACGTTATCCCAATGATGGGCTGCGCGTTCGGGTACTTGCTATCGGACGTGTGCGCCGATGGCATTGTGGTGGAGTTGGCACAGC
GAGAACCTCTTCAAGTGCGAGGCAAGACGCAGACGGTGATCTACACGACGCGGACAGTGTTCAACATGTTGGCATATATCCTTTTGGGCTTTTGCTTCAA
TGGTGCGGAATACGGCGGAGACTTTGACTTCTCACTGTCGTTCCCGATGCTGATGTTGATCGTGCTGATTGTGCTTTCGCCGATTGTGCCAGTCACCTGG
TTCTTCCTTCATGAGGAGAAGAACGCTTTCGGGGCTATGAACTTCAGTCACTACATGCACACCCTTTGGGATGTCATCAAGACACGAGCCGTGTACCAGT
ACATCGCTTACCAGTTCTTCTCGGGCATTTTTGCTTCGTTTACTTACCTTTCCAAGAACCCGATCCAGAGGAACTGGGCGAACGTCTCGCCGATCGCCGA
AAAAGTTGGAGGGCTGTTGTCAACGAGCGTGTACGCCACGTCGATTTGGTTCGCTGGCAACTACGGACGCAACTGGGACTGGCGACGAACGGCAGCGGTG
ACCATGATCACGTACGTGTCGCTGGATGCCTTTTGCAAGCTGCTGACGATCTGGAATGTCATCCGCTCGCCGTTTTTCTGGCTTGGTATCCCCATTCTGG
AGCAGATTCCGCTGGGTGTGATTTTTATTGTGAGCTCCTTCATCATCGTGGAGCTTGCTACTGAGGGACACGAAGGCGCCATGTACGGCCTCCTCACGAC
GGTCTATAACCTCGCCATCCCGTTCGCCACCGCTATTACGCGCAACGTGGATAGTCTGTTTGACATTACCACGGAGCGAATCCAGAACGACAGCAACGAA
ATCCGAACTGACATGGCCATGACGGTGGTCATCATGTGGGCAGCCAACTTGTGTTCGCTCGGTTTTCTGGTGATGCTGCCCCGCCAAAAGGAGCAGACAC
GGGCCATGAAGCAACTGGGCGGCTCGAGTTACTTCATGGGCGTCGTCACGGTGTCGTATTTGATGTTCGCGTTGCTGTGGACGTGTTCGACGAGTCTGCT
GAGCATCTTCGATTCCACTGCGTGTCTTGTCATCGCTGGTGGCAACGGTTGCAACAAGCCAAAGAGTCCGTAAGAAGTCAAATAAGTCTATCTAAAATGA
AAACTGCAGCGCTAACCGCTGCCAATTGAGTCTCTTCACCCTCTCCACTCGAACATCTCTCATCTAGCACAAAAGCACAGCATACTGTAGCAGTAGCGCT
CATTCTCCAAGAAAGTCTACACCATCTCCAACACAGCCAACTCGACAAATGCCACGTCCTCTTCACTGAAAAAGCGACCAGTCCTTGACCGCGAAGGACT
GCAGCGCCTGCTTAAATATGGCGGCGGCCACCTCCGAGTTGTCCTCGAACTGAAAGGCGTCGCGGCTGCTGCTGGCCGGGTTGATGCGCATGGGTGCCGA
CATCGACAGCACCACGTCCGTGGTCACGCCAGGCAGCCGCACGTTGCCCAGGTACACGCGCACCACGTTCTTGGCGTGGTCGCCCTCCTTGAACTTGGCC
ACGCGCTGGTCGCCCACGATGAGCTGCGTGGTATGCGGCGCATCGACGGCGGGCGCGTTCCGAGCGTCGGCCGCCGCCTCCAGCAGTACCGTCACCTCGT
CGGGGCCGCAGCCGTTGGACTGCGCCAGCTCGTTGAAGAAATAGCGCGCGCTGCGTGCGTCCGAGACGCTCTCCTCGTACTGCAGTAGCTCCACAATGAC
GCACTGGTCCGTGGCCGCGTTGGCGAAGACCTCCTGGTTGTCTGGAACCTGCCGGAACGAGCTCACGTCCGCGAAGCCCTCGGGGATCTCGCAGATCAGC
GCGCCGCCGAACAACGGACGCAGCATCTTGACTTGGGTTGACACTTGACTGAGGGGTTGATGTGGAAGTGAGCTCTTGGGTTGACACTTGCCTGAGGAAA
GTGACTATTGGTGTACCGTACACATATTTGGTATACACCAGTGGCCTGCGGCATCCAGCTATACTGTGTATAGGTGTGTCCGATTAAGTATCCACGATTC
GGATGGGTCGCGGCCATTAGATCGGAAATCAACCAGCAGCAGCAGCATGAAGATCGAGGAAGTGCAATCCACGGCCAAGGCGCAGCGCATCGCGTCGCAC
ACGCACGTCAAAGGTCTTGGTCTCGAGTCGGACGGCTCGGCGCTGCCCATTGGCTCGGGCCTCGTGGGTCAGGAGAAGGCGCGCGAGGCCGCGGGACTCG
TTGTGGAGCTCATCAAGTCCAAGAAAATGGCGGGGCGCGCTTTGCTTTTCGCGGGTGCGCCTGGCACGGGTAAGACGGCCATGGCTCTGGGTATCTCCCA
AGAGTTGGGGCCTAAGGTGCCGTTCTGCCCTATGGTGGGCTCGGAGGTGTACTCGTCCGAGGTCAAGAAAACGGAGATCCTGATGGAGAACTTCCGGCGA
GCCATCGGCCTCCGCATTAAGGAGAGCAAGGAAGTGTACGAGGGAGAAGTGACGGAGATGACTCCAGAGGAGACGGAGAATCCCCTCGGCGGCTACGGGA
AGACCATCTCCCACGTCATTGTGGGCTTGAAGACCACGAAAGGCTCCAAGCAGCTGAGACTCGATCCCAGCATCTACGAGTCGCTGCAGAAGGAGAAGGT
CTCGGTGGGTGACGTCATCTACATTGAGGCGAACAACGGCAGCGTCAAGCGCGTGGGGCGCTCGGACGCCTATGCGACTGAGTACGACCTTGAGGCAGAG
GAGTACGTGCCCATTCCCAAGGGCGACGTGCACAAGAAGAAGGAGCTGGTACAGGACGTGACGCTCCACGATCTGGATATCGCCAACGCCCGTCCGCAAG
GAGGACAGGATATTATGTCCATGATGGGCCAGATGATGAAGCCCAAGAAGACGGAGATCACGGAGAAGCTGCGCACGGAGATCAACAAGGTCGTGAACAG
ATACATTGACCAAGGTGTGGCAGAGCTTGTTCCCGGTGTGCTGTTCGTGGATGAGGTGCGTGATGCAGGTGGTCTTGTTTTGGAAGAGTGATGAACTAAC
TTTACATTTTTGTGCTGCTGTAGGTCCACATGTTGGATATTGAGTGCTTCACTTACCTGAACCGCGCGCTGGAGTCGACGCTGGCTCCGATCGTGATCTT
CGCCACCAACCGCGGTGTCTGCCAGATCCGCGGCACCGACGTTTCGTCTCCGCACGGCGTGCCGCTCGACCTGCTCGATCGCATGCTCATCATCCGCACG
ATGCCCTACTCCGTGGAGGAAATGGTTCAAATTCTCAAGATCCGCGCTGAGGCAGAAAGCATCAAGCTCTTGGACGACGCCACGGTGCGTCTGGGCGAGA
TCGGTTCACAGACGTCGTTGCGATACAGTGCTCAGCTGCTGACCCCGTCCCGGATCCTCGCAGAGACTCAAGGCCGCTCCGACGTGTCGGTGGACGACAT
CGAGGAGACCAACGACCTGTTTAGCGACGCCAAGCGCTCGGCGCATGCACTCGCGCAGACGGAAGGATACCTTATGTAACGACAGACAAAGATACCTGCA
TCAAAGCGTCTGTCCGCCAAATACAATTGAAGGGTCACTCGCTCATTGACCTCTTGACTCGTGCTCTCCTCCTGTTTCGCTAGATGCAATGGAATCCATG
AACAGTGAAGTTGTGCGGGAGTCTGCAATCTTCGCAGCACTGTCTCCACGAGGGTACTCACGACGTGAACGCCCGCCGGGGAACACGGACCTTCGAGGCG
CTTCGCCAGCAGATGGTGGGGCTGTACCGAGTGGGTCGCTCCCACCGGTGACTCCACGTGATGTAAACGCCATTCTCCGAGCCCCACCGCAACAAAGCAT
GAAGATGTCGCCAAAGACACCTCAATCGCTGATGCTGTCGGTTCCCATGACAACAAGCGAGTGCTGGCTCGTGTGGAAATTCTTGTGCGATTGGGTAAAA
ACGCAGGTAAACATTTACGAGTGCAGCAACTCGAAGATATTATGATCGGACTACATGTATAATAATTGTTTGTGTGGCGATATGTCATAGCTCGCGATGG
AAGTTCCTGCTTCGATCCCTGGTTTCGGGACGTTTTACCTACGGGTCCAGTCTTTAGGCATTCGTATCACGCTTTTTGGTAAGTGAAAACTCGAGCATGA
GACTAGTACCCAGGTTTTGTGCAGTTGTAACTTTTTTCCGGCTTCGTAGAACCTGACAAGCAATTCCTCAACAAGTTTGGGCTTCTAATGGATTCGGAGA
TTCCTGACCCAGCACTTGTTGCCGTGCTGCCCCCAACGATGTCTAATTCCGACACATTGGCATCTACCGGTAGCCGTGGCCGAGCAGCCAGTGTTATCGG
GCTCGGCAATGTCTTTGCATTTAGTTTCGTGGAAATGGCTGCATGCTGTGGGGACGCAGTCGATGCGAAAAGAGCTCAGGAATGGCTCACCGTGGTCATC
CACAAACTGGGAAATGCTTTGAGTCAATGTGGCCGAGTATGTGCAAGCCCACATATTTGCTGGTTGCTTCTATCGCTAACATTTACCGCTACTTGCAATA
GGTAGAACTAAATATCGGTGTCGGGGTAATCGTGTGTTCTGATCGTATCATTCGACGGCATCTACGCTCACACGATTCGGTATACGCACTATGCTATCAA
GGCTAGATACATGATGGGAAAAGTTTGGCTAATGAGGTTTGTTTATGCCTACCGCGTAGCGTGCTTCTCCACGACTGGAGTATGAAATTCGAACAGGAGA
AAGTGTTGTCAAACGAAACTTGCGGGCTCAAGCCGCTCTTCAAACCGTCCATACACCAACTAAGAACAGGCATGTCAAGGTTTACGATCGGTACTTTGTT
GCAGCCAAACTAATTATTGCATGTGGTCTCTGTGTGCATGCTTGCAGGTTCTCTTTTTTATCGGGGTCCACCTTTTCTTCATCGATCCAGCTAAACCCTG
TGGTAGACCGATCCAAAGACGTTCCAGACTTCTCGTTTGGGCCGCCAAACCCGCGACCACCGACATTTACTTCTGTGGGAGTTACTTCCGACAGTAGGTC
GACTCCACTTTCGACTCAACTAAAAAAGCGATATCAGCGATCACCCAGCCCGCTAATCAATCGTATCAGTACTCATGTGACCGCACCGCAACCACCAGCT
TATGAAGGGCAAGCAGCAAATAGTACACCGCCAATGCAGAAGCAAACAGAAGAGATTTGGATGCCGCCGCAGCTATTTGATGGACTTAGTCGGACACTCT
GTGTGGAACCTGATCAGAATGTGTCGTTCTTACTTCCCTCGAATCGTATTGGGTCGAACTTCACGGAGTCTGCAGTGTTTCTGATGACAGAGAAATCCGC
GTCTCAATTCGGTCAGCAAACTCAGCACGTCGGGGGGTTGGTATTCATCGACAATCCGAGCTTCACTAATCTTCAGCTGCGACGCAAAAAGAAAGAGTCG
ACTGACAAGTCAATATCTGAACAACGATACTTCGAGTATTTGTCCGATGACAAACTAATTGATCCCCGCTTCCTTGCGCCGCTTTCTTCTGAGCTCGAGA
CAAGAGTTGTGACCGCCGCTGTGAAGTATATTGTGGGACCATCGAGTAATCATATCGAAAAGGTGATGGAAACAGCGCATGGTGAATTTACAGACAATTT
CTACTCAAGCGCCAAGAAAGCGATTCTAAACTACCTCTTGATGCGGGCAACATCCTGTGAGCGGCTTGGAATTCCACACGGAGTACCAATTCACGCCGTC
CTCCCAACAAAGTGGAAATGGGGCAGTAGCGATGGACCCAATGGCTGTCTTTCAGACTTAAAGGCTTTGGTTTTAAAACATGGGGGCCGACTCACAAACT
CCAAGCGCCAAAGGAACACCTATGCGATCCAGCAAACATTAAACACGGAGCGTTCTCGTTACTCGGAGGCAATTCATAATAAGGCCGTGCGTCGTAAGCG
TGTACAGTCAAAATTGATGTCGCTATTGGTTTTGTCGAACCCCCAGGTTCGGGCTCTACGTTTCATGTGGTATGACTTGCACACATCAGCCACATTGGTT
GATCTCCCAAGCATTGAAGGGCTCAGCGATGTCATCGAACCCATGGATATCATTAAGTTTGAACGAGCTCAGCTCGCTTTTTCTGCGAAAATGAAAACCT
TTGTCATGGAAAATTGGTACGTGAAAACTAAAATGATGTTCGAAAGTGCCGTCCGAGCCGAAACCTTTTCGATACACACATCAGAGGCAGCAGTGAACTT
TCGCCTGTGCCACCTTTTCGACACCGTAGCGGCAGTAATGTCTCTCCAGCTCCGCTCGCTTATTATGAAGTCAATCCAAGCTTACGTCAAGTTTTTCGAG
CTGTTTGGGACGATAAATGAAGATGAACAGGAAAGCGGCAGTCTACGAGCCCAGGGTCGGTCAGCGCTCTCTGGTTTGCAAACAACGCTGGTCTTGAATG
ATGGGCAAATACAAGTAAGTACCGCTTTCATTTAGCAATTATCTTTGCCACGCTAGCTGATGCGTATGATTTCTACTTACAGTTTCGAGACCCTCTCGTC
GACATTCCAAGTCGCCTGTTGAACGTTCTTCACAACATACCCAAAATGTTTTACAACCTCGGACGCATCGAAACACAATTTGAGGAACCACTTGTGCTGT
CCAACACTTCTTCACCATTTCTGTGGAACGTAGCTTCACAGGAGGACGACATCGTCGTTGCCACGATTCGAATTCGATCGATCATTGAGCACAACCTAAC
GTTTTTGCGAAAGCTGCAAAGCGAATACGACGTGTTCGCCCTGACACACCGTTACGTGAATTCTGTTGACTGTTTTCACCTGGAGGAAAACGGAGAACTA
GAAACCTACCGGGCTGAGATGGAACGCGTGCAGGCAACCACTATGCAGCTCGCGATCGACAATAGACATTCACAAAATCTTGGTCTTTTTTCAGTCGATT
GCCGCCTCGTGAACACCAAGTTACACACCGAACTTGCCCAGTGGACTATTCGACTGTTTCAAGCGTTTGAGCAGCGGACAGGTAGAATGAATGCTGAGCT
TCGGCAGCAGTACAAGGAAATTGCAGCTCGATTGGCAAAGAAACCATTGGATTTGTACGAACTCGTCGATGCCGAGACATTTGTGCAGTCGCTAAAAGCA
GCTAAGCTACAAGAACTTCAAGACCGGGGTAACTCTATCAAGCAGCGCCTTCGGTTCTTGCTATTTGAGCGAGAAAATATGCACATTGGTAATCTTGCAA
TTGACTGGCCTCCAGATGCACCGCCAAACGATGAAAGTGACGCTTCATCCGTACAGGTGGCAGGTTTCCGTCTCTCGGTTGATCTCCTCTCTTCGACAGC
GAAGACTGTCAAATGGCGTAGTCATATTGAGAAGTTGCTGAAAGAAGCCGAATCGCTGCTTGTAAACGAACGTGCACGAATTGAGGCCATGTTTATTGCG
AAAAGGTCTCGATTTCAGGCTGAAATTGAGGAGTTTGAGAGCGAGGTTAGAGGGTTTGCAAAGAAAGGAGATCTACGACATGCCGCTACGTATGTTGTTC
AGCTTGCAAAAATGAAGGACAACATGTTTATTTTCCGGCAGGCGATGGAGACTATCGTAAAGGAAGAGCGAAAGCTACAGTGGAAGCCAACGGATTTCGG
CAAACTCGATGATATAGCAGAGGAGATGGCACCATATGAGCAGCTGTGGAAGACCGTAAGAGAATTTCGCGAGATGAACTCGCGGTGGTTACGTGGGAAT
GTATTCGAGCTACCAGGAAAGGAAGGAGTCCAAACTCTGCAGCAAATGCTCACTGTCGTTGCCAACGTGTCAAGCGTGCTCCTTTTGAACTCAGCCGCGG
CGGCAATCACTGCAGAAACAGTTCGAAAGCAAATGACAGACTTTCGTGAGAACGTTCGGCTAATAATTGCCATTCAAAATCCAGCGATCAAAGAGCGGCA
CATGAAAGCGGTGTCTGGGCTCATCGGACTGGACTTTAGCTCTGAAGAAACTATCACGTTGTTAAAATTACTTGAGAATGGAGCTTTTGAAATGGTGAAT
GAGATCGTCGATATCAGCTGCAATGCAACACAGGAACAACAGAT