Description :
From Genome Similarity Track
Location :
Scaffold_100:64742- 66793
Transcript NameFunction/comments
g8733.t1hypothetical protein

Sequence
2051 bases(100 bases per row)
ACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGC
GGGCTTAGGGTTTTGATACAAGTCAATAATAAAACATATCGATATAAAATATAAGCCTTTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGC
GAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCTG
TCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTA
TTATTATACTACGAGCCCTCTCATTGGCTATATAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGAACTACATCACATTCGGAACTAGCC
GAATGAAATCACTGCTGATTGGACAAAATATACCGCCGTTCAACAACTTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGA
CGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGG
GAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGG
GCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGA
CCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCATAATTCC
AGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGC
CCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATC
CTAGCCCCGGGCTTGACGCCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAA
TCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGC
GCTCGAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTT
TACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAA
AAAAAAGAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAA
GGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAG
GACTGTGCAAGACTGGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAAGTATCGACCGTCCTTTTACTAACGACTG
CAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGA
ATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGT