Description :
From Genome Similarity Track
Location :
Scaffold_121:64741- 66845
Transcript NameFunction/comments
Hyaar_Emoy2810229reverse transcriptase

Sequence
2104 bases(100 bases per row)
GACCTCGAGACGGAGCGCACGACAGAGTAGCAGCAGCAGTAGTAATGGCTACTGTGGGGTTGTTGTGGGCCAGCCGGAAGGCGAGTTCTACTTCGCAATG
ATAGGAAGAGCCGACATCGAAGAATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTA
GCTTAAAATTCTAAAGAACTAAAGGATCGATAGGCCACGCTTTCACGGTTTGTATTCATACTGAAAATCAAAATCAAGTGAGCTTTTACCCTTTTGTTCT
ACATGAGATTTCTGTTCTCATTGAGCTCACCTTCCGGCAAAAATTTGTGTACATACCCTCGAGCACAACCAGGTTGTCTGCATCCCTCTTTTGATACTTT
TGAAAAGTGGACTACTAACCGTTGCGCTATCACGATACCATTGGTCGACAAAGACTTCAGGAACAGTTTAGAATTGATTCGCTGGAGTGCGGGCTTTCGA
CGGGCAAGGGCAAGTCCGGAATGTGAGCAGTCAACAGCGGTGCAACGCACCACATCTGCTATGACAAGTCCAAGTTTGAAGTTCTGGACGAGCGCAATGA
AGGCGAAGTGAACTGAATCAATCTGCAAAACACTATATAGCAGCAGTCACTGAAGAAGGAGTATGATGCTGTTAATGTCTGTATTAACCCAGTACAGTAT
GGTATGGCAACGCGATCAGCCTTTGCTTATGGGCTCATATTCACCTGTATTGGTTTTAAGCGAATCACGTGCGTGCGTCACAATAGTGACCTAGCCCAAG
AGTGACTTTGAATACACCTATGTACCTATGAGAAGGGGACAGGCTTGATCGCACTCATTACGTGTAAGGTACATCTAACCGCGTAATTTACAGACATACA
CAGATAAGTACGATTTAAAAGTTCGGCATTCAACCTTGCGCACAGTCACTAATAGCTTCACCCTTCAAGCTCGCAATTACTTCTCTTTTAACCTAGTCAA
GCAAACATCAACAGCGGCCGCTCTGCGAGCACTTGCTTCAGACCCGACCAAGCAACAATCCTCTCCTCCTGTTGAGGCTGCTGCAGCTGCCAACACGGTG
CACAATATCGACGATGACAGCGAGAAGGCCAAGGAGTGGTGGGGACGACCGGGATGGGGACATCGCTGGGGAGGCTATGGATGGCGACGTCCTTGGGGTG
GTTACAGTGGTGGCTGGGGTGGATACGGTGGCGGCTGGGGATGGTAGACATCACACATGAAAGACACCATCGACACGCTTGCAACCTGCCGCACTCTCAC
ATGGACGGAAGAACAAGGCGACTGCAATGTAGCCAGTCAAATGGAAATCAGCATGCTCATTCAGCCTCGCTTTGTTCTCTAGCGCTGTGAGTTCGTCCAA
TGTTGTTCTGGTCGCCACTCGGTTCAACCTTGTCATGAAGTATGCACTGGCGAAGTTTCGCGTCTATCTCCTTAAAGATAGGCAATTTGTAGTCTATACG
GATCATGCGTCATTACGCACGGCCGTAAACAGCCCATACATCTCGCAAAAGATGACGAGGTGGCTGTCCTTCTTTGCGGGGTACAACTTTTCGTGGATTT
CAAACCCGGACGACTTAATGTCGTTGCGGACGCGTTTGTCGTGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATACCACTGTTGC
AACACTAGTCACGAGTGTTCCGTTGTCAACATTGCTTGACGACATTAAAAAGGCCTACGCAGAAGTAAATCGCTTCTGAGACTAATGGATCATCTAATGA
CTCCATCTCGTAAATCTCTCTAAGATTTACCGGCTTTATATCGATCTTCCGCGGATCGATACACAACACGCAACGGGTTGCTATTATACAGCCGTTACCG
GCGACGCACTTCGTGTTGTTGTCCCCACTCATAATGATTTACGCTTGCGCATCTTGTATGAGTGCCATGATGCACCACCTAGTGAGCAGACTTATTTCAC
GGTATGTCGCGACTTTTACTGGACCCGCCAGTATCAGTTTGTGCGCATTCGTGCTTGTGAAGTGTGCTAACGGGTGAAGCCCAGTCCTTCATCTCGTATG
CCAC