Description :
From Genome Similarity Track
Location :
contig_38:64740- 94984
Transcript NameFunction/comments
g8690.t1POM73604.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora
g8691.t1OWZ24229.1 hypothetical protein PHMEG_000765 [Phytophthora megakarya
g8692.t1hypothetical protein
g8693.t1hypothetical protein
g8694.t1ETI40580.1 hypothetical protein F443_14058 [Phytophthora parasitica P1569
g8695.t1hypothetical protein
g8696.t1KUF64454.1 hypothetical protein AM587_10013204 [Phytophthora nicotianae
g8697.t1XP_009519956.1 hypothetical protein PHYSODRAFT_485256 [Phytophthora sojae
g8698.t1ETP10341.1 hypothetical protein F441_13990 [Phytophthora parasitica CJ01A1
g8699.t1hypothetical protein
g8700.t1XP_008909558.1 RuvB-like 1 [Phytophthora parasitica INRA-310

Sequence
30244 bases(100 bases per row)
ATTCCGTTCGTGGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGCGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGT
CACGATATTTGCTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTC
CATCGCAGAATTTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAAA
GAGTATGATCTAGTAGACACAGTTGGAGACGATAAGGTCCGATAGATGTCCAAGCTTTAATTCAAGACCACATGGCCAACTTAACCGAAGCCGATCCAGG
TTTGTGCTTGAATTATTTGCAAGTAACCAGTTGTGACCAGGATAGTTCAGAGGCACGAAGTGAAGCTACCAGCTCCACGTTTTCGAGGCCAATGAATATT
CACGCGCGACACGAGCTTTGGCGTTGGCATGGACAACTTTGCAGTCGAGTCCGTGGCCGCGGAGGTGGTAAAGATGAACTCGAGCACGCCCGAGTTTCAG
AACAACAAATTCCACGGGTCGCTCAAGAACACCAAGTTCATCAGCATTCGCTGAGTTGTCGAAGCGGCCTCATCGCCATCAGCAGCAAGATCATTGTCGT
TTTCTCCCTGGTAGAATCTTGCTTTTGGTCAATGTTGCGTTGGCTTAACCACGGTGTAGTAGCGGTCAGCATAACGAGCAGAGGCCCCAACAGATCATCA
TCCCAGCTTACGGAAAGACAACTTGGTTCCCAAAGAGCTCCCGCGGCACTGGGAACAGCTGACCGAGCGAAAAACAATGGATCCGGGACTGTATCGCCTT
TCGACTGTGCTTTCGCCTGAGTGAAGTTTGTTGGTTTGACCCATCGGCGTCGATGCCAACGCGTGAGCCCCCGTACCGTTAAAATGACGAACACATAGAT
AATTGCAGCAAGGGCGACGGCCAACATATCGCTGTAAACGCCTTCGAGGTTCATTTTCCACCCATCTAAAGTCTCAGAGCGCAGCAGCATAAAGGTTGGC
ACTGGCTCCACCTCATTGGCCTCCAAGATCCTTGCGTCACGGTCGTCGACAGCTATCCCTCCATGTGCTACAAAAGCCACGGCACCGAGTGCTAAAGCGG
GTAATAGATGACCACGCACACCTGAAACGCCATGCGAAGGAGTCCAGGCACCAGCTGAGGTCTGCAACAGCGCTCGGAACCGTGCCAGCAGCGCCATAAG
CCAAATACATCGCATATGGACAGCCAACCAGCGCGTTAGTGCTGAAAAACTCTCCGTCGCGCTTTCTCCACCGTCATCTTCCAGTTCGTAAAGAATCAAG
GCGTCGATAATATGTGCACTGCGTAGCAGACTACGGGTAACCAACTGCCATACACCACAACTTGGCTGGGGATAGCAAAGAAGACACGTAGAGCGTGCTT
CATTCTTGACGTATCCGTGCCGTCTTCTGACCAACATTTTTGTCGACAACGGCAAAACAGGCGACAAGCAGACACACCACTCGCACGACGACGTACAGTT
GCCCGATAAACGCAGTGTTGATGCCAAAGAGCTCCATTCGAGGGCGTCAGTGTAGAGGACTTTGCCCTCGATACGCTCATCAAAAACCGCTATCGTCTTA
CAGACACGTGCGTCAGTGCATTGTCGAATCCGGTAGAGTGCCACAACATTGTAAATCTTGTGAGCAATCAAAACAGCCCCACCCAATCTTGTCAACGGGT
CCGATTCAGCCTCAACTAGCGTGACATCGAGCTTTTCACCATGTGCTAGTGTTGCTTGTAATGCTGCAGCACGCGATGACACAATCTCCCATAGTGCTTC
GCTTTCGGTATCGTCGACGGGTAGAGCAGCAGCCCACGGTTTCTCGCAAAAGAGTGGCCGATCCAAGTCGTCCACGCACAAGTCGACTCCAGGATTTTTG
GTGTCGAGATCGGTGAACGTTGTAACCCAAACGCTGAGCCAATACTTATGATCCAGCAAGTTGCGTGACAGAAAGCTGGTGCTGCTACTCGCAGCAGTGG
AACCAGAACCCGCGCTACTCGTACCGGTCCAGCGAGCTTTAGCACGAGCTGAGAAGCACACGCGTTGGGGCAGCGAACTTAGTTCGCCTCGTGCCATGAT
CGCGATGCCTTCTTCTGTTTGAGCCACATTCTTGTAGCTTGTAGTGCTTGGAGCATTGGCCGCCACCGCCTCGACAAGGGTATCGAGCATGTTGAACACT
GTTACTGCAGGCAGGGAATCGCCACAGTCGCTACTGTACGACGCGCCCACGGAATGAGCGCTTAGTAGGCACGTCGGCCAGGATGAATCCAGCCTTGGGG
ACCCCTCCAGCAGATCACGAACGGTGCGTAGTCCGTAGGAGCTTGGAGTGAACTTGTAGAGCGCAGTGGATACCTTTGAGCTGCTGGCCGAGACTCCGTC
TGTGGCCACCGTGCCATTTTGAAAGAGCGTTCGACTTGGTAGTGCCGTGGGTCCGTACACCGTGAAGACATTTGGCTCGATCTGAACAAACGGAAGCGAC
GTCACGCTCGATCCCGCACGCGGCACATCGGAAACGAGCAGCGCGTACGCGAAGAGAGCCAGGATCACTCGGAGAGCGGTGGATCGAGGCAGTCCCTCGA
CGAAGGTAGCCGTCTCGCGTGCACCGTCCGGATGCATCGCGTGCAGCAGCAGCGACGAGCGTTTGCGCTGCCAATTGTTTTCGGTTGGTACAGCAGAGGC
CGACGGCGCTCCGGATGGCTGGGCACCAGGTCCGGCGGGTGTCTTAGCTCGAGTGTCGCTGTTGAAATCCGGATTCGCCTCGACGTCCTCAGTTTGGTCG
TGCGGCGACATGCGATTCTTGGACTGGTGCGGAGACTCGAGAGCACTGCCGATGCCCCCATCGCTAGTGGCCATGACGGCGGATCCGAAGCTGCAAGTAT
TGGGAATGCCGACTGTTGCCCCTACTGCTGGATGGTCGGCGGTTTCGACAAAAGATGCCAGCTTCGCTTGTAATGTATGGCCATGTTTCTGCTGCAGGAG
TCGGCATGAGGCCTGGCCCTTGATGTGAAGCTACTGCTGGAGACGGTTGTACCAAGTCACAATGGACTCGAGCCCCGAAGGGCTTTTCGTCCGACATGGC
TACATCTCGAGACACTGTGTCCACGTATTTAGTGCAGTAGCGGATACACATGTACTTTGCCACCCACCACTTCCTTGCTGAGTCACCCACTTCCAGCGGA
GTCTCCAAGTTGGCGTCTCCGAGCTTTATCGGTTGCATGGCCTCCATGGTTAATGCCCCATAGTGACCGCATCTCCGCTTCTCGCTTGAAGCTTACGCCA
CGCCTCCAATAGCCAAGTGCACCATTGCACCATGAAAATCCATCGCAGCGTGTGACTTGCAGCGGCCATGTGGGCGCGGTATGGGTTCATTTTCGTCCAA
TCATGTCCCGAAATCGCGTCCCAGAGCCGGCATCTGCCCAGCCACTTCATTCCCGGACTTGCCATCGCTCGACCAACTTGCCGCCCGCCATGAGCATCGA
CTGGTCACTTGAGTGCTGCAACGACAAGCAGTTCCTGTCCATCTTCCTCATCATCTGCTACGCCGTCGCCATCTTCAAACTGTGCGGCCATCGATAGGTG
CTCCACCGAGCTGTTTCATAGTCTTCTAACCTCCTTCTCTTTCTCCCAGATGGCGCGTATCAATCCTCCACCCGTTTAAAATCCTGTACGTAGCCATTGC
TGCCGACGATTTGAGGGTTTCCTTATAGCTGACTGGGTTGTCGTGGCTGCAGAACGGTCTTCCTGCACGAATTGGGGCATGCGACGGCTGCGTGGCTCAC
TTGCGGCAGCGTACGAGACCCCCGACCTAGTATGATATGAAACAATTGACCTGATGCGACTATTGCCGCTTTGCCCATAGGTTAAAGGAATGGAGGTGCA
CCCGGACGAGGGCGGTGTGACCAAGACTGTCGGCGGACTGCAGTGGGTCATCCTCCCAGCTGTACGTCGCTGTGGGGAAATTGTGCTTTTGGCAATGTAC
TGACGTCGTCAATTGGTGGCAGGGGTACCTGGGATCGGCAGTGTGGGGCATGGCGCTGATGATTGCGAGCGCTGACAAGACTGCATCGGAGGTGGCAGCG
GGCGTCCTCGTCTTCTTCCTGCTCATCTTCATCTTCTACGCGCACAACGGCTACCTGAGGATCCTAAATTTCTGCTTCATCCTGCTGCTCGCGGGCTTGC
TGGCACTCAACATTTGGACGACTTTCGACGCGCTGCAGTACGTGACGCTTTTCCTGGGCGTCATGAGCTGCCTCTTCTCCGTGTACGACATTTGGGACGA
CCTCATTTCGCGACGAGTGAACGAGAGCGACGCGTCTGTCTTTGCCAAGATGACTCATACGTCGAGTCGCTGCTGGGGGGTTATCTGGGGCATTATCGCG
CTCGTCTCGCTCGTCGCTGCCGTTTATTTCAATTTGCTGGTTGCACAGGACTCTGGCGAGTCGATTACGAACATCTCCGACGCCTCCACAGGCACGAAGA
TCGCCCTTGCCTGCGCCGTTATCATCGTGGCCCTCGCCGTGCTGCACACTGGATTCACGCGGAGATGTATGCTGCGCAAGCGTGAAGGGTTCAGGGGCTA
CTTCTCCGCATAGATATTATCGTGGCGATGCCAGTACTCGAGTGCCTTCATTATCCGGTACTGGGGTGCGTTTTACGCGGTGGAACTTGGGCCAAATGAT
ATTTCTTCGTCTCCGTTGTAGATTTCTTTCCTGTGTCGTTATCACTCTTTACTGATGGCGCTGGAAACCAGGCCACACTTCTCTACGATATCTACCAATA
CACTGTACCTACCAACTCACTGCGAGCACGTTCTAAATGCTTAAGGCGTCATCCTCAAAATCTCTTTGTTCGGGTTTGTCTTGCTGCCTTCTTGCCATCT
CTATGGAAGGATGCCGTTGGTCATGCGCTGGAAATTGTCGTATTGACGAGTGCTATAGTTGTTGTTGCTCTTGCGGATAAGTGATAGCACGTGCGCCACG
GTTTCTTGCTTGGATAACGACAGCTTGAAGCGTGAGCGCAGGCGCAATAAAATATAATCAGCGTCGATGCCCAAGAAGCACGGGTATGGCGACTGACGTG
ACATAACATCCACGAGGTCACAGATCTCGTCACAGTGCTGTTGGCACGCCAGGAAACCCCGCGTGCAGAGCGTAACATACTCCTTGAAGCCTTCGGAGTC
TTGGCCACCCATAGTCTCTACCATTTCGGCCGTCAGTTTGAACGGCGCCGTCTCGATGCTAAGCATTCCACCCGGAGCGATACCAAGCAAGAAACCGTAG
TCGATATGGATAATATGGCCTTCGTTGTCCAGCATGATGTTGCCATTATGCCGATCCTTGATTTGAAGGAAGTAGCACACAATCGAGTATCCTGCCATGG
ACTGGATGTATTTCCGTTGTGCTTCCTTGAATCGATGTGAATCCGGCGGTCCGTAGGACTTTTCAAAGTGATGAAGCAGAGAGACATACCCTTCACGCTT
CTTCAGACCATCCAGAGAAATAGCGTTGATGAGGGTCTCAATCAGTCCCGTGGACGAGCTCGTAGCGATGATGCGGTACCTCTTCACCCACATAGGCAGA
TTTGCTCCCCTGAAAATCTCGACAAACTTCTGAATCAACTGCAGAGTAAACACCTCCTGTCGAAGATCGTCATTACTCTTGCCAATCATTGACACGATAT
CCCACCCAGGTAGGTGCCCGTAAGGTGATGCGGCACACAGCCTTGTTCGTTTGGAGCTCCACGATTCGCCAAAGGCCGCCTCGAAGTCTCTGCGGCGGGC
CTTTTCACGCTCCACGGCCTCTGCAGTCAAATCACCCGTAGCCAAGTCCATTTCCAGTGGAGCTGTCGGCGCACCATCGGTTGTCGTTCCACTATCCACG
GTAGCGCCCACGTATTTTCAATTAGTATCGGAGGCGCCGTTGAAGGTGTAGAACAAATATCGGGAACATCAATAGGCGTCTCAGGAACTGGGGCCCGGCG
AATTGCAGCGACTGGTGTTTGATATGGTTCTGGAGCGATAGGAGGAGGAATTATAGTTTCAGCTTGGATTTCCTCCACATCATCAGCTTCTCCAGCAAAA
GCTTCACTGGCTTGGTGACCAATCAGCTGACCAATCTCATCGTCCTCGACGTAGTTGACCTCAGAAGATTCCAGCGCACCGTTTCCGTTCATATTCTGCC
TTGAGGGAGACCGCGGTGATTCGGGAAGCGAGGTATCTTGCTGTTGGTCGTCGGTGAACGGGTTGCCACGAATTACCTCGAAGATCAGCAAAATAGGAAC
GCGAGCTTCGTCGAGAAAGCGGTGCCTTCCTTGGTAGGTATCCGCACAATACGTTCGAATGGGTCTGTTGCCTTTACCAACGGCACATACGCCATGGGAG
GGAGATGCAGTTTCTCCAAATACGATGGGAGTTGTTGTTTTCGATCCTGAATGGACGGCACGAAGCGCAGAGCCTCAGCAATGTCAGTGATTTGCTCCAC
AAAATCACATTCGTCAGCGAAATGTTTTGCCAACAAGTGCTTATCCGTTTGGCTCATTCGACGCATAGACTCACTGAAGATGCTGGTTGGCTGGTTATCG
GTGTCCTCTTCCTCAAGAACCGACAATCGTTCATCTTGTTCATAGTCGTTATCTGTAGGATGCGAGATCAGCATAGAATCAAGGTCTTCCTTGGGTGTCA
ACAAATGCTGTTGGAAGCGCGAAAAATCACGGAATCGACTATCGACATCAGCATCCGACCCGCTGCGATCGGTGCCATTCCTAGCCAATGGCGGGGACAA
TGGTGGGTATGGATTCATAGCTGCAGGAGAGCCATTGGCGAGAGCGCTGCTTGCGCGAGACGACGGTGGGTCGCAATCTCCTCTGTCAATTTAACGATAA
CTTGCAGCTGATCATCTGTGGGATTCGGCAGATTACGCTTGTGCCCCTGGGCTGTCTCCTGCTGCGGATCGCGACTGAGCACGGTTGCACGGTCTACACC
GGCAACCTCGCGCTCAATCTCGACCATCAATCGCACCACACGTGGGTATTTATCCTGCATGTCCTTGGGTTTCCTCGGATCAAAAGAGTCCTCCAGCGCG
CCTTGTAGTTGCCAGCGAAGAAGAAGAGCTAGGTGGATAGATCGCGAGCACACCGACAGGATGAGCTCGTCAGCCAGAAAATCTTTTCAAAGTCAAAGTT
CGGAATCGATAGGTACGCGTGCACGATCTGCGGCCAGTAGAATTCCACTTGGTTGATACGCGTGTACGAAAAATGCAACAGCTTCTCCACGATAGGCTTA
AACAACAGAGGGTCACTGTCCAAATAGCGATGCAGCAGAATCACAGCACGATAGACGCTAAAGCTGCGCACACGGAACTCGCGGTGTAGACCTAAGATTT
TCAGGTCTAGAGGTATCTCTGGATGGTCCATGGTGTGATCATAAAAGCGTCGATCCTTCAGCAAGATCTCTTCACATTCTTCAGCAGTAATTACCTTTGC
TTTGAGCAAGTCAATAGCAATCTTTGCAGACTCAGTCTGCAGCGGACGCTTCGGCATGATGAGCTCAATCGGAGCCTCTGGATTCAACGGACGCGGATAC
AAGCAAATACCAGCCTTCAGTCGCTCCATCATCGCACGCAAATAGTTAATGTAATTCTGTGCCTCATAGCAACGGTCACACACTCGCTTGGCGTAGTAGT
GCGACCTCTGCGGGAGCGGCACTTTGTGCGTCGTAAACTTGTCACAAAACAGTCCATCACAACTGTTACATTTGTACAGCAACGCAGCAGCAGTCGGGGC
CAATTGCCCCGCAGAAGCAGCCTCTGCTACCAACTGCGTGCAGTCCGGACACTTGCACGTCACATCTGTCTCACTCGATGGCACCGTCACGGTGCTCACG
GGCGAGATCGACACATCCAGCGTCGCGTGCTGAAAAAAAGCTGCTGTAAGGCGAGGCACCGTGGTCTCCACTGACGTCTGGATGGCACGGATCCATTTCT
CTTTGTCCATGGCCGTGTCCGCGTAGGCGTAGAAGACCTTATTCTGCGCCGTGGCAAACAGGAAGCCGTGCTGGTAGATGTGCATGTTGCCTTTGCCGTC
CCACTCCTGCACCCCCAAAACGTCCGCTTCGCCCTTGAGCCGCAGCATGTGATACGCGTCCTCCTGCGTGCTGCTCGCATCACAAACCCAAAGCAATTAG
CACCAGCAGTCAGACTAGTACCAGAATACAAATCATATACTGTACCTATAGTATTGGAAGGAAGTGCCCACGAGGAAGCAGTAGCGCCGCAGCATGGGCG
GGGGTGACGACGGACTCGTGCGGAAGGTCAGGTAGCCCTCACAGCTGGCGCGCGGGGCCTTCATGGAGCTCCACGAGATCAGACGCGGTCTAATACGACG
GCGGCGTCTCGTGGTGCTGCTGAGTGTTGATGTGCGCTCGCAACGGGGCGCGCAATGCCGATCTGCGCGTGGACTTGGGCGACGGCTGATTACTCACCTC
CGACGCACCCAATACACACGATCAACGGATCACCGGACAGAGCAGACGGCGGGGGGCACGAAGAGTCTGAAGCGGACGGCCACGCGACGCTAGGGACGCG
TATGGGGAGAGGGAGCGCGGGCCGAGAGCGCGCGAGCCTTCTCTCTTCAAGTGGGCGTTGCGGTGTTGCGTGGGAGGGGGGAAGAGCGACCCGCGTTATA
GTGGCGTGTCACAATCATGCGGGAATGGTACCATGAGTATGGTACACTCGGTTTTGCTGGTTGCGAGCCCACCAGCAATTCGTGCATCAACGCATTCGCG
ACTGTAGTAGACCGATGGCTCGCGGGAAAAAGACGTTGGCGGCACCGCTGAAGGCGTCCACGCCCAGCGTCAATGGCGGCAGCAAAAGCAGCAAAAAGAC
GGCCGGCGTGGCGCAGAAGAAGCAGAGCAAGCAGGTGAAGCCTTCCCCAAAGAGCCCCAAGAAGACGGTGAAGGTGGCGGTGAAGGCGGAGGAAGCAAGC
GAGGGAGAGGAAGAAGACGAAGAGGCCAGCGATACTGAGAACAGCGACGACGCTGATGACGAGGAGGATGACGAGTTCGAGGACCAGGGATCGTCGTCGG
ACGATGACAGCGGCGACGAGGAAGAGGACGACGCGACCTCACGGAGCTGGAAAAGAAGACGCGGCGCTTCACTGTGGACCGCGAAAACGAAGTGCAGAAG
ATGCGTGAGGACGGGTCGCTCCAATTGGCATCGCAGTTGCACGTGGACGACCTGTCGTCTGATGACGAGGTGGCTGCCAATGCTTGATGCATGTGTTGCG
ACGTGTGAACTTATCCTTTGGTTGTGCTTTTGCAATGATAGGAAAATGTCAACACTATTGGTAACGTGCCACTTCGGTGGTACGAGGATTACGACCACAT
TGGTTACAATGTGGACGGCAAGAAGATCATGAAGTCGAACAATGGCGACGGCATTGACAACGCGATTGCCGCGAAGGATGACCCGAACTACGAGTAAGTG
ACATCGAAGCCGTAGGATTCCTCTTACCTGCAGACGTCTGACTGTGTGTTTGTCCTTCTTGACAGCCGCACCGTGTACGACGCTTACAACGACCGTAAGA
TTGTCATTTCGGAACGTGACATGGAAATCATTCGTCGTATGCAGGCGGGTGCATTTGCACACCCGGAGTTCGAGGCTTACCCGGACTATGTGGACATTTA
CTCGTCGAACAAGATGATCCACTCCATGGGCAACGAAGTTGAACCCAAGAGCCGTTTCTTGCCTTCGAAGTGGGAGCGCATGAAGGTCATGAAGATCATG
AAGGGCATCAAGGAAGGTCGCATCAAAATCGATGAGGAGCCAGAGAAGAAGCCCGATGTATACCAGATGTGGTTCGATGATGACCAGGCGCAGACTCGGA
AGGGTCCTGCTCACGTACAGGCTCCGAAAATGCCGCTGCCCGGACACATTGAGTCGTACAATCCTCCTGATGAGTATCTGTTTACTAAGGAGGAGCGTCG
AGCTTGGGAGGAGGCCGAGCCGGAGGACCGCGAAACTAACTTCATGCCGAAGAAGTTCAAGTCGCTGCGTGAAGTGTGCGGTTACAATGGCTTCGTGCGT
GAGCGCTTTGAGCGTTGTCTGGACCTGTACTTGGCGCCGCGTGTGAACAAGCGTAAGCTTAACATCGACCCCGAGTCGCTTGTGCCGGAACTGCCGAAGC
CTCAGGACTTGCGTCCTTTCCCAAACACACTGGCGCTTGTTTTCAATGGCCACACTGGTCGTATCCGATCGCTGGCTGTGGACCCGTACGGCCAGTACGT
GGCCTCGGGCTCGGACGATTTCACTGTGCGCATCTGGGAGATCGAGACTGCGCGTTGCCTGCAGGTGTACAACGTTGGTGCCGTGGTGCACAAGCTGTCA
TGGAACCCGAACAAAGACCACCAGTTGCTGGCTGTCGCGGCTGCTAAGAAGGTCTTCATTATCGCTACCGGAACGGGTAGCGCGGATCAGACGGAGCTTA
CCAATGCCCTCGTGGGCGACGCCGACGAAAGCATTCAAACGTCCTCCGAGAAGGATGACAAGACAGATAACGCCGATGGCGACGTCCAAGTCGTTGATGA
GGATGAGGCCACCGTAGAGGCTGACGCGCTTAAGAAGAAGGTGCCTGTGACTTGGCGATTCTACAGTGGCACGAAGGACAAGCACAAGTCAAAGAAGGCT
GCAGAGCGACCGTGGCTTGAGCGCCGCGTGGGTACTGGTATTCGTGTGGTGCTGCACCACACGAGCGACGTGAAGGACGTGGCCTGGCACCACAAGGGTG
ACTACCTCTCGACGGTTGCCCCTGGCGCCGGCTCCGGAGCGGTGCTAATCCACCAGCTCTCAAAGCGCAAGACTCAGAACCCGTTCCAGAAGAGCGTGGG
CCAGGTGCAGTGCGTGCTGTTCCACCCGTCCAAGCCGTTCTTCTTCCACGCCACCCAGCGCCATGTGCGCGTGTACAACCTTGTGAAGCAGTCGATCGTG
AAGAAGCTATCCTCCGGCGTCAAGTGGATCTCGAGTATGGCCGTGCACCCGAACGGAGACCACCTGCTTGTGGGTAGTTACGACCGGCGGTTGTGCTGGT
TCGACCTGGACCTGTCCTCGAGGCCGTTCAAGACGCTCAAGTACCACGAGAAGGCTGTGCGCGACGTGTCGTTCCACGGCAAGTACCCGCTCATGGCTTC
TGCCTCGGATGACGGCACCATTCACATCTTCCACGCCATGGTCTATTCGTACGTATTGCTTGGCTCTTGCATTTTCACAAGTGGCTTCTGAGGCGAGCCA
GAAGCGATTAATTGAGGTGCCTAACTGCTAACTCATGTCGTGGCGTGATCTCTGCAGGGACCTGATGAAGAACCCGCTGATCGTGCCGCTCAAGATCCTG
CGTGGCCACGAGGTCTCCGGCGGCCTTGGCGTCATGGCGCTGGCCTTCCACCCCGTCCTGGTACGTTCCTTCTGCCGCTCAAGCAACGTCACGCCATTAC
TACCGATCTAACTCTTGTTGCAATTTGTGTTGATTCGCTCAGCCGTGGGTGGTGACAGGCGGCGCGGACGGTTCCATCCGCCTCTTCCAGAACATTCACT
AACTCGCCCGTTGCAGCGACCGATGAATCCGAGCAACCGTCCACAAGACGTCGGCAGCGGTGCGCTTCTGCAGCTTTCGAAGGAGGAAATGCGCGCTGCC
GTCTCGGCGTGGGCAGCTAGCAACTGTGACGATTTCAACTAATAGACAATGTGCCTTTGAAACCTCAATGCTCGATGCCATAGAGACGACGATCGTTTGT
GCCTCCGTTTTGAGCTGCCGGTAAGCGGTAAGGCTCAGGCGAACAGCAAATTGCGCCAGGCTCATGATGACGGCACACCTCGCCTTTCCTAAGCTGAAAG
CCAGTGCACTGACGCCGCTGCAATGCTACAGCAGCATGGACACTTTGGTAGCATGACATGTGAAGTCCTTAATTTATTTATCATGTAAAGGAAGAGGAAG
AGTACGCGACAGTCTCAGTCAAGCTAAGCTACTCGGTCCAAGCGGATGGAACAGTCCTCCCTCCATCTGCACGCATCAGAATACACCACCACGGGGCTCT
ACTCGCCGGGAGAAAGAGACCACAATACTTGATCATCGTCGTCCGCCCGCTTGTCCCTTTTCTCGGCGAGGCTGCACGCAACTTCCAGAGAGCCACGCGT
CCGTCCTAGTTCTTCTTGCCCATGCCCGGGATTCGGAACCGTGAGCGCTTAGGAGCTGCTGCAGGCATCGGCGGCGGCATCTGGCCGTATCGCACGGGGT
ACTGGTACTGGCCGCCTAGGGTCGTGGCCGGGTATTGCTGCTGCTGTTGGGGCTGACCATACTGCTGCTGTTGTCCATATTGCTGCTGCTGGGGCTGACC
ATACTGCTGCTGCTGGCCGTACTGCTGCTGAGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGTGGCTGGTTG
TTGCCGTAGCCGTATGTCGGTTGTTGTTGTTGCTGCTGCTGTTGACCGTACGTCGAGTTCTGCGGCGGGTACGTACCCGTGGCCATAACCGGCGGGTAGC
CGGCGTTGTTCATGGGGTTGGGGCGGTTCTCCTCGTCCGAGTTGCGCTGGTTGGCGTTGGAACCCCCGCGCTTGTTGTTCATGGCGTAGAGCGAGCCCTC
TGTGGGCTCTCCGTCGCCGTCCAGCAGGCTGGCGCCGTCCACTTTGCCCTTGCGGTCCAGCACCGTGTCGCCTGAGAGCACCGCGCGGTCCGACTTCTTC
TTGCGCAGGAATCCCACCATGGTGAGAATAAGGAGGGCAGGTGGACGGTTGCGTGTGTAGATAGCAGAGCGAGGGGGCCGCTGCTGCTGAGTACCGAGAG
CTTCCTTGCGGGGACCGGGACGATTCAAGTATGGCAACGCGCGTGCGTTTGGCTTCGAGTGACCAGCCGGAAACTGCGCCCCCCTGCCGCTCCTCTTCTA
TGCTGAAGAGATTTGTCGCAATTTTGTGGAAATGCGGCACTGGGCGTTTGTATGGAATTTCACGTCAGCGCGAAAAGGCGCCAGCCCAGAGGCCCACTGC
GGCTCACCTAGTCTCGAACTCCACAGCCAAATCCACGTGGACGCACACGAGCGAGAAAGCTTGCTGACAGATGGCCACCAGACTGGGAGTGACTATGCCG
GCCTGTCGTACGGTTGTGTCGCTCTACAACGAGGGCTAACAAGCCGAGTCTGTGCGTAAACCGCAGCGGCAGACTGCAACTTGTCGTGCAATGGGTTTAC
GACTCGCAGCAGGGCATGTACCTGTCCGTCGCTGGGAGAGCTCCGAATTACTGCTACGTGCACTGCAGCTTTCCACGAAAGCAGACCATCTGACAACACA
CCGTTGCCAGCTCGCAAGCCGAAAACAGCGGTTTAAGACGAGGGTTTCAGCTGCGGACAGCGGAGACCCACGACGACGACGAGATGGCGAAGCCAAGCCA
AGATATTGCATCCGAGGGTTCGTTCTGTCGGCTGTCGCCGCGCTTAGCTCAACTTGCCTGGGCGTAGCACCGCGTCAACACGGTTGCGTCCGTTTCCACC
GCTGCGCTAGTGCGAAATTCAAGTTTCAATTTTTAAGTTGCAGTGTCATCGCAGTGGTATCTTACGTATCCAACGCGACTTTTTGAGGCTGAGACATGTG
CAACAAAATGGCGAGTAATTGCAGCGAGACCAAGCACCACAGCCTCGCTGGCAGCAAGTTGCTGCTCGCTACGCTCGGCCTAGTCGTCGTCGCCTGCTAT
GACCAAAGAGCTTCACGTCCCGGGACGTCTGTGGTTCACGACGCTCAGCCCAGTCGATGATGCTTGACCGATCACATCCTTCAGACGCGGACTCGCTGTC
TGTCTGTACGTCACCGCAATGACCGCCCGAGGACAACTTCAACCACACAGCCTCACAACGACGGCAGCCAGCCCGTGCAGCCACTTTTCGATCGCCCGCA
TTGAGTCGAGGCTCGACATCCCAGAAGAGCTCTCTCGCCGAGTGCGTGGCCTGAATGAGTCTCTACACCAGCACGTAACCAGACCAGCCAGCACCAACGT
TGGCTTCGTACTACCTCCACGTGTCCAACGTGCGACCGAGCGTTGCATCGAGCAGCTGTGCGGCCTGGGCAACGGGCTGCACAATGGCCTGCATTGACGG
TGTGCCTGGACTTGCACGGCAAGATGCAGTGAATCTGGCCCTGCGGCATTTCTATCAACAGAAGGAACAGCAAAGTCCGCGAGGGTTGGACGTAAGTCAA
CAACCAAGTTCTTCACTCATTACCGGTCCTGTAACGAGTTGATATCAACACACTTGGTAAGAGCATTAGTGTATTAGCACGCTACACGACCATCTCAGTC
AGGTTGGCGTGGTGACTGTTTGTGAGGGTGTCTCTGTGTAATGGTGGTTCCAGTGGCGACCGGGAATCTGTACTGCTATGCTGCGGGTTAGTGTCTTCAC
CACGTCACGTGTTTGTCGAGGAAATCCCGTGTCATCTCCTCGTTCTGCGCTATGTTCTCCATGTAGGTATCATAGGACATGTGCCACGGATCCGGCACGT
CTCGCGTGAAGACGGCGAGCACGCTATCTCGCTCTGTGATCTTCGGGAACTTCTCCGTGACCTTGAAGGCCATCCCGCTCGCCACGCACACCACGTAGTC
GGCGTTCATGCACATTTCCTCTGTCAGCAGCCGCGAGCGGTGAGCCGACAGGTCCAACTCGTACTTCTTCATCACGTCCACCGCGAACTTGGACGCGGGC
GAGCCCTCGCGGTCGAACACGTCCGTTAAACTGCACGGCGAAAACAACCATCAGCAATTTCGGCAGCCTCCGCAAGTTCCTAACAGCGAGGTTCGCACGT
ACGCTGCCGACCGGATGACAATGCCCTTCTCTTCCTGCTGCTCGCGCGACATGTTGAGCTTGCGCCGGAAGTACTCGACAGCGAAGAGCTCCGACACTGG
CGAGCGACACGTGTTGCTTGTGCACACGAACACGATGTTCATGGTCTCTTGGCGTGTGCGGTGCGGACACAATTCTGATGTGGAGAGCTTGCTGCGACCC
GCCGCCCAATGGTTACAAAGACTCCACAGCCAGCAGTAAACGAACGGGGCTGGAGGTGACAATTTCGTTCCCGCTCGCCTTGTTGGCGTCGCCGACTTCA
AGCGCGATGGCCGTCGCATGCGTGCGGAGTGGATTTGCAGCAGATTTCCAGGCGACCGCCTGAAAGCTTTCGACCGGCATGAGCGACAAGCAATATATCT
ACATGCACGAGCAAATGCACACGAATATGCACAATTTGGTGGCGAATTTGCCACACGGGAACTATATTTGAAATGCCACGAATGTGCTTCCAACGTATCC
AATGCAACCGCAGCTAGTTTACTGGAAGCGCTGAACGACCTTCGCGTACGGGAATGGTCCCAAAAACTCGCTGTGGTTTTGCTTCTTGGTAGACGCCTTG
AGCAACGAATAGTCGAGTTCCGTGTGCAAGTCTTTGTTGGCAGCGTACGACTGTGGATCCCACTGGATGTCGAAGCTGTTGACGAAGAAGCCCTGGAATT
GTGCGATCCATTGACGCAACGCCATGTACGGGATGAAGTAGAAGCCGCACCGGTCAGTGTCGTTCTCCTTCACCTCCTCATCAACGGGTGCCAGAGTAAG
CGCGATGTAGACCTCTAGCATTGGAGGCAGGCACATCTCGCGTGCCACATGCTGCTCTGCCGAGTACTCCCACAGGCACATGACAGTCATGCGGTCGCCC
CAGTCCGTCGTGTTGCGAACGAAGTAGGTGAAGTCGCTATCCGTACGACATAGCTCTGAGTCCTTGCACTTCAGATGTAGTGGCTGAATATTGACGTCTG
CGAACACTTTTGTCTCGTCCGAGAGGCAGTCTTCGATACCTTCATTATACTCCAGGGTGTTGTTCGCTTGCTGCTTGAACGAAATGCCTTCATTGCCGCA
CTGGTACCAGTTGAACGGGCTAGATAAATGTACCAAACAGAAACAGTTAGTTAGTCATTTTACAGAGTAACCATGCTTCGCAACGTACTTGTAGCTGTTG
GGGCAAACCGAACGCTCTTCCCAATCCGAAACCTCCTGCATCCAGTATGCGAGAGAGTGACTGCCTTGATAGGGCCCATCCGCCCAGGAGTTCTTCACGA
TAAGTCCGCCAGTGAAGCCTTCGCGAGTAAGGAAGGCGTCATTGTAGCCTACAAGAAGCTGCCAACACAATTGCAAAAAATACCGGGTAAATGACGTAGT
CGTCACACAAATCTGACAAATAACTTACCATGGCGTGACCACCCTCGATTGACATGCCACGGTGGCTAAAGAATTCGCCTTCCATGTTGCGGTTTCGACC
TCCCTTCAAAGGAATGCAGCACGTCGTAGTAGCCATATCTCCTGGACACAGCGTACACGTTTCCGGCTGGCAGTGGCGATCATTCGAGAACGCGCCAATG
CACGGGTAATAGTGAGTGACCATGGCGATCGGAGTGGAGAGAGGCATTGCTTGATTTTTGCGGACAAGGTGCTCCCTCACGGACATGTCTTCATACTTGG
TCGTCATGCTCTACAATATCGAAATCGAAACAAAACACAGTGTTAGCCAACCTAATTTCCGATGTGATTCTTGACCGAGTCTCTTCGCTTACAGAAAGCT
CGAACTTGAGCGGATTCCCAGCCGTTTGGGCGGCCTGGAGACCTGGACAAAGCATGTCGTTGCCGTCTTCGGCGTAGTATTCGCAGACAGATTGCGGGAA
TACAGACTCTTTGAGACCATTTTGTAGGTAATAAAGTTCCGGTACCTCTCCCCCCTCTGTCGAGTTCATCCACATCTGTATATAGCAACGTCAGCATTTG
ACAATAGTTCCAAACAATAGAATATGGCTGACCTCGTCACCCGCCACTCGGCAATCCTTTTGCTGCTGTGAGTCTGCATCACCGGTGCAAAGCTGGAGGA
TCTCCACGCCGTACGCCTGCAAATAACCACATCGATAATAAACACCGATGTTCTGCAACAACTTCACTCAAGGATATTAGTCCAACGTACCTGCTCAGAA
AATGCAACATACTCATTAGGTTTGAGCCAGCCTTTGCGGACACCGTGTGCGCGATACGACTGCTCTAGGAACCCGATCGTCGCAAAGTCCCAGCACGTGC
CACGATAAGCCTGATCCTGGCGCGGAGTCACGAAGTCCACCGCGAACTTGGATGGCAGCAACGCCATCGGGATCAAACCATTTTTGGAGACGAAGCTCAT
GGCCACCGGGTCGAAGTCCTCATGAGCAGCATTCGGCGCATCTTGGCGGGCTTCGCTGGCAGTCTCCCTGCAACAGCATTAGGTCAGTAATGATAACAGC
CAAACGTTAACAACTCTTCAGATCTTTGCAAGGCACATACCGGTACACGCTGCTGCCAGCCTGAGTTTCCAGACGCGAAATCGTGTTGTTCATTGAGATA
CATAGGAACAGGAGCACGAAAAGCGCGACGCCGTTCACCGCATAGAAGACCGTCCGCAAAGGAAGGCGGGGCAGTGCACCGCGCTTATCAGCAACAGTGA
GCTGTTGCGAGTGGACGGGCAATTCATCTCTGTCGTTGTTAGCTGGGTACAAGCACCATAACGCATTCGCAGACATCGTTAGCGTGCGATAAACAAACTC
GCCTCTGGGCTCTAATCGTACCTCTCCCGGAGCCGTAGCGTAGCAGAGGACTGCGGTCTCTAGCGGAGACCGACCTCACCATTCGTCGTGCGGTGTAGGA
GACGCGTTGAAGAATGACGTCTAGCAGCCGATCGGATTTCTGATCGGCAAGTACATCCGAAATATGCTTACCGTGTGCAAACGGACCAGCGAAGGACGCC
ATTTCTATCCAATCATATTCCATATTTTTCAAATTAGAAACGTTTGATTGGTTGTTTATGAGGTGCCCGTAAATGGCGAACGTCCGTTCATACACAAGGT
TCACGGTATTTGTATCAAAAATGACTTCACTTCACTAAAGGAGAGCTGTCTGCAAAACGAGACCTGTAGCTCAAGTTGACCGTCGTGACTGTGAGAATGC
TATACCTATAGATATTAACATAGTTTTTCCTTCAAAACTGTCATCGCAGACTACTGTGCATCTACTCTTTGCAGCCATCGCCACCGGCGATCACGAGACA
CGCGGTAGAATCGAAAATGCTCATGAGGTTGGTCATGACGGACCAAATGAGCGAGAGCGACAGATACGCCACCGTGACAAACCCCATGAAGTAGCTAGAG
CCTCCCAGACGCTTCATCATTTGGGTTTGTTCCTTCTGTCGGGGAAGCATCACCAGGAACGCGAGCGAGAACAAGTTGGCCGCCCACATGATAAGTACCG
TAATGGTAACGTCGTGCCTTACTCCTTGGGAGTCGTTCTGGATCCGCTCCGTTGTCAGGTCGAATTGACCATTGACATTGCGGGTGATCGCAGTTGCAAA
AGGCGTCGAGAGGTTGTAGACCGTCGTGAGCAGACCATACATGGCACCTTCGTGCCCTTCCGTGGACAGCTCGACGATGATGAAGGAGCCCACGATGAAG
ATGATACCTTGTGGAATTTGCTCAAGAATGGGAATTCCCATCCAGATCCACGGCGAACGGACGACATCCCAGATTGTCAGGCTTGCCCACAGCATCCAGG
CTCACGTTGCAAATCATAGTCACGACCGCCGTACGCCGCCAGTCCCAGTCGCGACCGTAGTTGCCGGCAAACCAGACTGCGATGGCAAACACGCCCGTGT
TGATGAAGCCGGCAATTTTATCTTCGAGCGGCGAAACGTTAGCCCAGGTGGTCTGGATCGGATAACCCGATACGTACGTGAATGACGAGAAAATACCCGA
GAAGAACTGGTAGGCAATGTACTGGTACACGGCCCGTGTCTGTACAACGTCCCAGAGTTCGCACATGTAGTGCTTGAAGCTCTTGCTATCACCCGGGCGC
TTCTCTTCGTAAATAAACATCCACGTGATCGGCACAATCGGCACAAGAGCGACTGCCACGATCAACATCATGATTGGGAACGTGAGCGAGAAGTTAAAAT
CGCCACCGTAGTCCTCGCCGTTGAAGCAAAATGCTACCAGAATGAGAGCGAGGTTGTTGAACACAAAGCGTGTGGTGTAGATCACAGTTTGGGTTCTTCC
TCGAATTTCGAGCGGCTCGCGCTGCGCCAACTCCACCACAATGCCGTCGGCGCACACATCGGCCATCAGATACCCGAACGCGCAGCCCATCATTGGTATA
ACGTAGACGCTGCCATCGTCGGCTGCGCCGTAGTTGAGCGTGGCAATGATCTCGGGCGTGTAGTCCTCGGGCTTTATGTCTCGGTACGCTGGGTCGGTGA
AGTACGGCTCGCCCTGGGGTGTGAGCACCATGACCAAAAGCATGGCTAGAGTGATGATCCAGCCGATGACCATGTACGGTCTACGGCGATAGCCATGGAT
CGGGAAGCAGTCAGACACGATGCCGTAGAAGACCTTGAAACTCCAGGGCAGCTGCACAAGCACAGAGGCTGTAGTGGTTTGGGAACCGGGGAGGTTGAGG
TAGTTCTGCAGGAAGGGGTAGATGACGTTGGGCAGCACTCCGTCAATTAATCCAACGGCCGCGTACTGCGCGACAAGGCCGATATACTGCCTCGAAAAAA
GTTTTGGTGCGCCACCGCTCCGGAGCGCGCCGCCTTCGATGTAGTCGTCGTACACGTAGCGCATTTTCCCGTAATGATGCGCGGGTTCCAGCGGCGACAT
GCTGCATTGCGAGTCTCCCAGCATCGCGGCCGCGTCAGGGTTGTACAGCTCAATCTGTTCCGGTAGTGGCATTTCGGTCTCCGTAGGCCTGAAATCAGAC
AGGCTCATGTGCTGAAGGCTGCGAATCGAAAACTACTGAGCGAGGGGATCTGCTTGCAGGGCAGATAGCATGGATAATCGCAAGTGGTGGACTCACCTCC
AGGCAGATGCAGAGGTCGGGCCGACTTTTCCGCAGGATGTGCAGTGTTAGTGGTTCACCTCGCCATATTGGCCGCCATACTGGTTTGGCATCATCGAAAC
TTTCTCATGAACAGAGGACAAAACAGAGGGCACCGAACACACGCAAGAAATGCAAATTCGGTAGGCGACACTATCGATTGCCGCTGTTGTAACGGCGTTA
TTGCATGGACAGTAAGGCTTATTTAGCTACACCTACGCTGCGAAAGAAGGTTCGAGCGGACGAGCAGTGAGATTCCGAGTCGGAGTGCACATGGTAATTC
GGCAAGGGCGTACGTATCCTAGACTCATGCCTGGTTGTAATTTGCTGGTTTGCTGGCTTGATGTAGTACGGTACCGGTGCTGGTATTCATACAGCAAACC
ACCAAACGACAACACCGGTGCAGCAAACCATTTGGTCAATCTGTCAACTGAGCTGCTCTCTGCAACTGGAGAGAGCACCTTCAGCTGGCAGGGGGTGCTG
ACCGTGACCGACCATAGGGTCCTCACTAAGCACTACTGACGTACTTGCACATACATCATACATGATCTACAGTACACGTAGGGGGTTGCACACATCTTGA
GCTACCATACCTGGCCTACGGGCTGGAGAAGGCCTGAGGACGACCACTCCAACGGGTGGTCCCATTCCGCCCCACACGGTACTTCAGCCATGGACCGGTA
CAAGCTGGCAAGAAGTCATCGACGACTCGCGTACGAGTTGTTGAGGAAGGCCGCGCACAGTACTCGGTGCGAAGAAAAAAGTTTACCGTTCATGCGGTTG
TAGACCACCCAGCAGACGCAGGAGCACATGGCACGCATGGTAAAACGTGAAGCAGGCTTTTCGATGCCATGACTTGTTGTCGACTGTATTCAACAGAGAC
CTGGCATTGAGAATGGCATCGGACGACGCGAACTGGCTTGGCCGGCTCGAGGCAAACGCCAGAGCTTCGTTTCTTGAGCGGTCGGGCTACGGGATACCTT
CACGATTTGAAAAGCCCGCCAATGTTGCACTGAACTGCTGGATGTACCAAACAGAGAGCCCGTCCGAGTCAAAGTCTCTGCTCGAGACTGTGAGAGAGGA
ACTCTGCCAAGGCAGCTGGCAGCCGTCGTCAGTCTCGAGGCTTCCTGCTCGATTTGTAGTTTCCCTGCGCGTTCAAGGTGGTACCCACCAAAGAAGGACG
AAAACTGGTGGAGGTGTCGTGCCGCGAAGCGAAAACCAGGGCTTGCTCGTTTCCTGTGAGCTTAGATATTGGACGAGAGGCTATCCAGGCCCCGCGTTGG
ACTGCGAGGCGTGTGTACACTGTAAAAAATCCGATCTTACCGCATTAGTCAAATTGCGTGACGAGAGGCACTCTACGACTGGTCTTGGTGGGTCTTGCGG
GTCAACGGACAGGTACCACCGTCATGAAGGCATCGCGGACTGACACGGTGACATCGCAGCAGGCACCAATCGAGCTGTACAACGAGGACTCGTGCTCGTG
GATGATCACCGATTCTCCGGACGATGGTTCGCCGTTCCCGATGACGTTCGAGGGCCAAAAGATCCGCTACATCTACGACGACTACATCGAAGGCGGCGCG
CTCCGGAGCGGAGACGCTCCGAATCTGTTCTCGAAGAAGTACATCGGCCTTGTCGCACAGTACGCCGGCGTCGGATTTATTGACGGAGTGCTGCCCAACG
TCATCTACCCCTTCCTGCAGAACTACCTCAACCTCCCCGGCTCCCAAACTACCACAGCGTTCGTCCTCGTACAGATGCCCTGGAGTTTCAAGGTCTTCTA
CGGCATCGTGTCTGACTGCTTCCCGATTCGTGGTTACCGTCGTCGACCCTATATTCTCGGCGGTTGGGTCTTCGCGTTGACCATGCTTGTGATACTGGCG
CTCACACCTCAGGGTGAGCGTACTTCACAGACCCAGCGTACCGAGACGTAAAGCCCGAGGACTACACGCCCGAGATCATCGCCACGATCAACTACGACGC
AACCAACGACGGCAGTGTCTACGTTATCCCAATGATGGGCTGCGCGTTCGGGTACTTGCTATCGGACGTGTGCGCCGATGGCATTGTGGTGGAGTTGGCA
CAGCGAGAACCTCTTCAAGTGCGAGGCAAGACGCAGACGGTGATCTACACGACGCGGACAGTGTTCAACATGTTGGCATATATCCTTTTGGGTTTTTGCT
TCAATGGTGCGGAATACGGCGGAGACTTTGACTTCTCACTGTCGTTCCCGATGCTGATGTTGATCGTGCTGATTGTGCTTTCGCCGATTGTGCCAGTCAC
CTGGTTCTTCCTTCATGAGGAGAAGAACGCTTTCGGGGCTATGAACTTCAGTCACTACATGCACACCCTTTGGGATGTCATCAAGACACGAGCCGTGTAC
CAGTACATCGCTTACCAGTTCTTCTCGGGCATTTTTGCTTCGTTTACTTACCTTTCCAAGAACCCGATCCAGAGGAACTGGGCGAACGTCTCGCCGATCG
CCGAAAAAGTTGGAGGGCTGTTGTCAACGAGCGTGTACGCCACGTCGATTTGGTTCGCTGGCAACTACGGACGCAACTGGGACTGGCGACGAACGGCAGC
GGTGACCATGATCACGTACGTGTCGCTGGATGCCTTTTGCAAGCTGCTGACGATCTGGAATGTCATCCGCTCGCCGTTTTTCTGGCTTGGTATCCCCATT
CTGGAGCAGATTCCGCTGGGTGTGATTTTTATTGTGAGCTCCTTCATCATCGTGGAGCTTGCTACTGAGGGACACGAAGGCGCCATGTACGGCCTCCTCA
CGACGGTCTATAACCTCGCCATCCCGTTCGCCACCGCTATTACGCGCAACGTGGATAGTCTGTTTGACATTACCACGGAGCGAATCCAGAACGACAGCAA
CGAAATCCGAACTGACATGGCCATGACGGTGGTCATCATGTGGGCAGCCAACTTGTGTTCGCTCGGTTTTCTGGTGATGCTGCCCCGCCAAAAGGAGCAG
ACACGGGCCATGAAGCAACTGGGCGGCTCGAGTTACTTCATGGGCGTCGTCACGGTGTCGTATTTGATGTTCGCGTTGCTGTGGACGTGTTCGACGAGTC
TGCTGAGCATCTTCGATTCCACTGCGTGTCTTGTCATCGCTGGTGGCAACGGTTGCAACAAGCCAAAGAGTCCGTAAGAAGTCAAATAAGTCTATCTAAA
ATGAAAACTGCAGCGCTAACCGCTGCCAATTGAGTCTCTTCACCCTCTCCACTCGAACATCTCTCATCTAGCACAAAAGCACAGCATACTGTAGCAGTAG
CGCTCATTCTCCAAGAAAGTCTACACCATCTCCAACACAGCCAACTCGACGAATGCCACGTCCTCTTCACTGAAAAAGCGACCAGTCCTTGACCGCGAAG
GACTGCAGCGCCTGCTTAAATATGGCGGCGGCCACCTCCGAGTTGTCCTCGAACTGAAAGGCGTCGCGGCTGCTGCTGGCCGGGTTGATGCGCATGGGTG
CTGACATCGACAGCACCACGTCCGTGGTCACGCCAGGCAGCCGCACGTTGCCCAGGTACACGCGCACCACGTTCTTGGCGTGGTCGCCCTCCTTGAACTT
GGCCACGCGCTGGTCGCCCACGATGAGCTGCGTGGTATGCGGCGCATCGACGGCGGGCGCGTTCCGAGCGTCGGCCGCCGCCTCCAGCAGTACCGTCACC
TCGTCGGGGCCGCAGCCGTTGGACTGCGCCAGCTCGTTGAAGAAATAGCGCGCGCTGCGTGCGTCCGAGACGCTCTCCTCGTACTGCAGTAGCTCCACAA
TGACGCACTGGTCCGTGGCCGCGTTGGCGAAGACCTCCTGGTTGTCTGGAACCTGCCGGAACGAGCTCACGTCCGCGAAGCCCTCGGGGATCTCGCAGAT
CAGCGCGCCGCCGAACAACGGACGCAGCATCTTGACTTGGGTTGACACTTGACTGAGGGGTTGATGTGGAAGTGAGCTCTTGGGTTGACACTTGCCTGAG
GAAAGTGACTATTGGTGTACCGTACACATATTTGGTATACACCAGTGGCCTGCGGCATCCAGCTATACTGTGTATAGATGTGTCCGATTAAGTATCCACG
ATTCGGATGGGTCGCGGCCATTAGATCGGAAATCAACCAGCAGCAGCAGCATGAAGATCGAGGAAGTGCAGTCCACGGCCAAGGCGCAGCGCATCGCGTC
GCACACGCACGTCAAAGGTCTTGGTCTCGAGTCGGACGGCTCGGCGCTGCCCATTGGCTCGGGCCTCGTGGGTCAGGAGAAGGCGCGCGAGGCCGCGGGA
CTCGTTGTGGAGCTCATCAAGTCCAAGAAAATGGCGGGGCGCGCTTTGCTTTTCGCGGGTGCGCCTGGCACGGGTAAGACGGCCATGGCTCTGGGTATCT
CCCAAGAGTTGGGGCCTAAGGTGCCGTTCTGCCCTATGGTGGGCTCGGAGGTGTACTCGTCCGAGGTCAAGAAAACGGAGATCCTGATGGAGAACTTCCG
GCGAGCCATCGGCCTCCGCATTAAAGAGAGCAAGGAAGTGTACGAGGGAGAAGTGACGGAGATGACTCCAGAGGAGACGGAGAATCCCCTCGGCGGCTAC
GGGAAGACCATCTCCCACGTCATTGTGGGCTTGAAGACCACGAAAGGCTCCAAGCAGCTGAGACTCGATCCCAGCATCTACGAGTCGCTGCAGAAGGAGA
AGGTCTCGGTGGGTGACGTCATCTACATTGAGGCGAACAACGGCAGCGTCAAGCGCGTGGGGCGCTCGGACGCCTATGCGACTGAGTACGACCTTGAGGC
AGAGGAGTACGTGCCCATTCCCAAGGGCGACGTGCACAAGAAGAAGGAGCTGGTACAGGACGTGACGCTCCACGATCTGGATATCGCCAACGCCCGTCCG
CAAGGAGGACAGGATATTATGTCCATGATGGGCCAGATGATGAAGCCCAAGAAGACGGAGATCACGGAGAAGCTGCGCACGGAGATCAACAAGGTCGTGA
ACAGATACATTGACCAAGGTGTGGCAGAGCTTGTTCCCGGTGTGCTATTCGTGGATGAGGTGCGTGATGCAGGTGGTCTTGTTTTGGAAGAGTGATGAAC
TAACTTTACATTTTTGTGCTGCTGTAGGTCCACATGTTGGATATTGAGTGCTTCACTTACCTGAACCGCGCGCTGGAGTCGACGCTGGCTCCGATCGTGA
TCTTCGCCACCAACCGCGGTGTCTGCCAGATCCGCGGCACCGACGTTTCGTCTCCGCACGGCGTGCCGCTCGACCTGCTCGATCGCATGCTCATCATCCG
CACGATGCCCTACTCCGTGGAGGAAATGGTTCAAATTCTCAAGATCCGCGCTGAGGCAGAAAGCATCAAGCTCTTGGACGACGCCACGGTGCGTCTGGGC
GAGATCGGTTCACAGACGTCGTTGCGATACAGTGCTCAGCTGCTGACCCCGTCCCGGATCCTCGCAGAGACTCAAGGCCGCTCCGACGTGTCGGTGGACG
ACATCGAGGAGACCAACGACCTGTTTAGCGACGCCAAGCGCTCGGCGCATGCACTCGCGCAGACGGAAGGATACCTTATGTAACGACAGACAAAGATACC
TGCATCAAAGCGTCTGTCCGCCAAATACAATTGAAGGGTCACTCGCTCATTGACCTCTTGACTCGTGCTCTCCTCCTGTTTCGCTAGATGCAATGGAATC
CATGAACAGTGAAGTTGTGCGGGAGTCTGCAATCTTCGCAGCACTGTCTCCACGAGGGTACTCACGACGTGAACGCCCGCCGGGGAACACGGACCTTCGA
GGCGCTTCGCCAGCAGATGGTGGGGCTGTACCGAGTGGGTCGCTCCCACCGGTGACTCCACGTGATGTAAACGCCATTCTCCGAGCCCCACCGCAACAAA
GCATGAAGATGTCGCCAAAGACACCTCAATCGCTGATGCTGTCGGTTCCCATGACAACAAGCGAGTGCTGGCTCGTGTGGAAATTCTTGTGCGATTGGGT
AAAAACGCAGGTAAACATTTACGAGTGCAGCAACTCGAAGATATTATGATCGGACTACATGTATAATAATTGTTTGTGTGGCGATATGTCATAGCTCGCG
ATGGAAGTTCCTGCTTCGATCCCTGGTTTCGGGACGTTTTACCTACGGGTCCAGTCTTTAGGCATTCGTATCACGCTTTTTGGTAAGTGAAAATTCGAGC
ATGAGACTAGTACCCAGGTTTTGTGCAGTTGTAACTTTTTTCCGGCTTCGTAGAACCTGACAAGCAATTCCTCAACAAGTTTGGGCTTCTAATGGATTCG
GAGATTCCTGACCCAGCACTTGTTGCCGTGCTGCCCCCAACGATGTCTAATTCCGACACATTGGCATCTACCGGTAGCCGTGGCCGAGCAGCTAGTGTTA
TCGGGCTCGGCAATGTCTTTGCATTTAGTTTCGTGGAAATGGCTGCATGCTGTGGGGACGCAGTCGATGCGAAAAGAGCTCAGGAATGGCTCACCGTGGT
CATCCACAAACTGGGAAATGCTTTGAGTCAATGTGGCCGAGTATGTGCAAGCCCACATATTTGCTGGTTGCTTCTATCGCTAACATTTACCGCTACTTGC
AATAGGTAGAACTAAATATCGGTGTCGGGGTAATCGTGTGTTCTGATCGTATCATTCGACGGCATCTACGCTCACACGATTCGGTATACGCACTATGCTA
TCAAGGCTAGATACATGATGGGAAAAGTTTGGCTAATGAGGTTTGTTTATGCCTACCGCGTAGCGTGCTTCTCCACGACTGGAGTATGAAATTCGAACAG
GAGAAAGTGTTGTCAAACGAAACTTGCGGGCTCAAGCCGCTCTTCAAACCGTCCATACACCAACTAAGAACAGGCATGTCAAGGTTTACGATCGGTACTT
TGTTGCAGCCAAACTAATTATTGCATGTGGTCTCTGTGTGCACGCTTGCAGGTTCTCTTTTTTATCGGGGTCCACCTTTTCTTCATCGATCCAGCTAAAC
CCTGTGGTAGACCGATCCAAAGACGTTCCAGACTTCTCGTTTGGGCCGCCAAACCCGCGACCACCGACATTTACTTCTGTGGGAGTTACTTCCGACAGTA
GGTCGACTCCACTTTCGACTCAGCTAAAAAAGCGATATCAGCGATCACCCAGCCCGCTAATCAATCGTATCAGTACTCATGTGACCGCACCGCAACCACC
AGCTTATGAAGGGCAAGCAGCAAATAGTACACCGCCAACGCAGAAGCAAACAGAAGAGATTTGGATGCCGCCGCAGCTATTTGATGGACTTAGTCGGACA
CTCTGTGTGGAACCTGATCAGAATGTGTCGTTCTTACTTCCCTCGAATCGTATTGGGTCGAACTTCACGGAGTCTGCAGTGTTTCTGATGACAGAGAAAT
CCGCGTCTCAATTCGGTCAGCAAACTCAGCACGTCGGGGGGTTGGTATTCATCGACAATCCGAGCTTCACTAATCTTCAGCTGCGACGCAAAAAGAAAGA
GTCGACTGACAAGTCAATATCTGAACAACGATACTTCGAGTATTTGTCCGATGACAAACTAATTGATCCCCGCTTCCTTGCGCCGCTTTCTTCTGAGCTC
GAGACAAGAGTTGTGACCGCCGCTGTGAAGTATATTGTGGGACCATCGAGTAATCATATCGAAAAGGTGATGGAAACAGCGCATGGTGAATTTACAGACA
ATTTCTACTCAAGCGCCAAGAAAGCGATTCTAAACTACCTCTTGATGCGGGCAACATCCTGTGAGCGGCTTGGAATTCCACACGGAGTACCAATTCACGC
CGTCCTCCCAACAAAGTGGAAATGGGGCAGTAGCGATGGACCCAATGGCTGTCTTTCAGACTTAAAGGCTTTGGTTTTAAAACATGGGGGCCGACTCACA
AACTCCAAGCGCCAAAGGAACACCTATGCGATCCAGCAAACATTAAACACGGAGCGTTCTCGTTACTCGGAGGCAATTCATAATAAGGCCGTGCGTCGTA
AGCGTGTACAGTCAAAATTGATGTCGCTATTGGTTTTGTCGAACCCCCAGGTTCGGGCTCTACGTTTCATGTGGTATGACTTGCACACATCAGCCACATT
GGTTGATCTCCCAAGCATTGAAGGGCTCAGCGATGTCATCGAACCCATGGATATCATTAAGTTTGAACGAGCTCAGCTCGCTTTTTCTGCGAAAATGAAA
ACCTTTGTCATGGAAAATTGGTACGTGAAAACTAAAATGATGTTCGAAAGTGCCGTCCGAGCCGAAACCTTTTCGATACACACATCAGAGGCAGCAGTGA
ACTTTCGCCTGTGCCACCTTTTCGACACCGTAGCGGCAGTAATGTCTCTCCAGCTCCGCTCGCTTATTATGAAGTCAATCCAAGCTTACGTCAAGTTTTT
CGAGCTGTTTGGGACGATAAATGAAGATGAACAGGAAAGCGGCAGTCTACGAGCCCAGGGTCGGTCAGCGCTCTCTGGTTTGCAAACAACGCTGGTCTTG
AATGATGGGCAAATACAAGTAAGTACCGCTTTCATTTAGCAATTATCTTTGCCACGCTAGCTGATGCGTATGATTTCTACTTACAGTTTCGAGACCCTCT
CGTCGACATTCCAAGTCGCCTGTTGAACGTTCTTCACAACATACCCAAAATGTTTTACAACCTCGGACGCATCGAAACACAATTTGAGGAACCACTTGTG
CTGTCCAACACTTCTTCACCATTTCTGTGGAACGTAGCTTCACAGGAGGACGACATCGTCGTTGCCACGATTCGAATTCGATCGATCATTGAGCACAACC
TAACGTTTTTGCGAAAGCTGCAAAGCGAATACGACGTGTTCGCCCTGACACACCGTTACGTGAATTCTGTTGACTGTTTTCACCTGGAGGAAAACGGAGA
ACTAGAAACCTACCGGGCTGAGATGGAACGCGTGCAGGCAACCACTATGCAGCTCGCGATCGACAACAGACATTCACAAAATCTTGGTCTTTTTTCAGTC
GATTGCCGCCTCGTGAACACCAAGTTACACACCGAACTTGCCCAGTGGACTATTCGACTGTTTCAAGCGTTTGAGCAGCGGACAGGTAGAATGAATGCTG
AGCTTCGGCAGCAGTACAAGGAAATTGCAGCTCGATTGGCAAAGAAACCATTGGATTTGTACGAACTCGTCGATGCCGAGACATTTGTGCAGTCGCTAAA
AGCAGCTAAGCTACAAGAACTTCAAGACCGGGGTAACTCTATCAAGCAGCGCCTTCGGTTCTTGCTATTTGAGCGAGAAAATATGCACATTGGTAATCTT
GCAATTGACTGGCCTCCAGATGCACCGCCAAACGATGAAAGTGACGCTTCATCCGTACAGGTGGCAGGTTTCCGTCTCTCGGTTGATCTCCTCTCTTCGA
CAGCGAAGACTGTCAAATGGCGTAGTCATATTGAGAAGTTGCTGAAAGAAGCCGAATCGCTGCTTGTAAACGAACGTGCACGAATTGAGGCCATGTTTAT
TGCGAAAAGGTCTCGATTTCAGGCTGAAATTGAGGAGTTTGAGAGCGAGGTTAGAGGGTTTGCAAAGAAAGGAGATCTACGACATGCCGCTACGTATGTT
GTTCAGCTTGCAAAAATGAAGGACAACATGTTTATTTTCCGGCAGGCGATGGAGACTATCGTAAAGGAAGAGCGAAAGCTACAGTGGAAGCCAACGGATT
TCGGCAAACTCGATGATATAGCAGAGGAGATGGCACCATATGAGCAGCTGTGGAAGACCGTAAGAGAATTTCGCGAGATGAACTCGCGGTGGTTACGTGG
GAATGTATTCGAGCTACCAGGAAAGGAAGGAGTCCAAACTCTGCAGCAAATGCTCACTGTCGTTGCCAACGTGTCAAGCGTGCTCCTTTTGAACTCAGCC
GCGGCGGCAATCACTGCAGAAACAGTTCGAAAGCAAATGACAGACTTTCGTGAGAACGTTCGGCTAATAATTGCCATTCAAAATCCAGCGATCAAAGAGC
GGCACATGAAAGCGGTGTCTGGGCTCATCGGACTGGACTTTAGCTCTGAAGAAACTATCACGTTGTTAAAATTACTTGAGAATGGAGCTTTTGAAATGGT
GAATGAGATCGTCGATATCAGCTGCAATGCAACACAGGAACAAC