Description :
From Genome Similarity Track
Location :
Scaffold_57:64732- 76437
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014019Similar to SPAC1039.06: Uncharacterized protein C1039.06 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G014018Similar to Egln1: Egl nine homolog 1 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G014017Similar to RH29: Putative DEAD-box ATP-dependent RNA helicase 29 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G014016Similar to TOPORS: E3 ubiquitin-protein ligase Topors (Homo sapiens)
Pytul_DAOMBR144PYU1_G014015Similar to pyr1-3: Protein PYR1-3 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G014014Similar to ILL7: IAA-amino acid hydrolase ILR1-like 7 (Oryza sativa subsp. japonica)

Sequence
11705 bases(100 bases per row)
CATGCGCGAGTGGATGGTGACGCCGAGCGTCGTTGTGGACGAGACACGCCTGCAGCGCAACGTGCAGCGTATGCAGCAGCTCGCGAACGACCACCACGTG
CAGCTCCGTCCGCACGTTAAGACCCACAAGACCGTCGAGATCACGGCCATGCAGCTGCAGGCTGGCGCGTGCGGCATCACGGTCGCCAAGCCCTCGGAGG
CGCACAAATTTCTGCACAGCGGTCTCAAGTCGCTCAAAAGCATCCTCGTGGCGTACCCGGTCGTGCAGACGGCCAAGATCGGCAAGCTACTCGTCGCCGC
GCAGCAGTTTGGCATGGAAGTGCGCATGACCATCGACAGTGCGGCCGGCATTGACGCCGTCGAGAAAGCGGCCAACTCGTGCGACTACCAGGTGAAGGTG
CTCATCCACATTGATGTGGGCTACCACCGCGTGGGGCTGGAGGAAGGGGACCCGAAGATCCTGGAATTCACCAAGCGCATTGAGAAGTCGCCGAACTTGG
AGTTCACGGGGCTACTCTCGCATGCAGGTATGCTCCATGGTTCATTATGATTTTTTTATGGCGCGCGTTGTTGAGTATGTGGAGCTTTGTGCTTCTTGGT
CAGGCCATGCGTACTCGTGCAAGACTGTTGAAGAGTGTGCGAAAATTGCGGAGACGGAGCGAAGCACCTTGGTTCGCATCAAGAGCTCGCTCGAGGAGGT
ACTGCGCTGTAAATCGCTGGTCGTAAATATTCATGGGTAGACTAACATGCGTCAATGATTTTTGGCCTTTGTTTGATCAGAGCGGCATCGCCGTTCCCGT
TGTCTCTGTAGGAAGTACCTTGACCGAGCCTGCTCGGAAGAGCTTTGTCGGCATCACGGAGGTAAGATTCCTTGTGCATGAGAGCTACTTTGTATCTTGT
GGACATCCGCTTGACTTAGCTTCTCTATGGCATCGCCGTGCCTCTGTTAGATTCGTCCGGGAAACTATGTCTTTCTTGATCGAACTCCGGTAAATATCGG
ATTGTTTTCGATCCAGGACGTGTCGTTGGGTATCCTCGTGACCGTCGTGAGCTCCAACAAGTACTACTTCATTGTCGACGCCGGCTCCAAGGTGCTCAGC
TCCGATGCGTACGTCCATCCAGTTTTAATCCTCACAATGTTGTAATTGGTCACTGTGGAGCTAAGCAAAAACATGTTTTCTGTCATTGTGTTGTGCAACC
GCTCTGAGTAGACCCCGTGCTGTCGAAGGCGGCACGTTTGGCACCAATTGCTACGGATTGGCGTTCTACGAAAAAGATTTCGAGCGACTGGACAAGCCGC
CGACACAAAACAAGTCGGTGATGGCCGACGGTCATGAGATCACGTGCTTTGAAGTCTCGAAGCTATCGGAAGAGCACGGCTGGATCAAGCAGGTCGAGGG
CATCGCGCCGCCACCCATCGGCCAGCGCATGATCATCTTTCCGAACCATGCCTGCGTTGTCGCGAACCTGACGGACAATCTCTACATCCAAGGAGCCCAG
TCCAAGAGCTGGAAGGTGTTCGCCAGAGGCTGCAGTCAATAGGAAAAGCACAAATAGCTGCGCACATTCTGAAGTGTTGGTCATCAAATCTACCGCCTTT
AGGAGCCTATAGGTTTGCTTCCTAAGCCATCATCAAATGGGATTCATCAAAACCACGCAAGCTGAAGGTTGTTGACAAATTCTCGCTCGCTATCTTGCAA
CAGTACGTCAGCAAGCTCATCGCAGGTCGCCGGCAGCGTCGAAGGTTGCACGGGGTCCTTGGCGCGAAAGTTGCGTAGCATCTGCGTCGTCGCGGCCTCG
ATCACATCCATTTCGTGCTCATGCGTGGCCATGTACTTGGCGAACGCTTCGGTTTGCACGTGCGATTCGTGTAGCGAACGTGTCCACTCGTCGGCATAAA
AACGCTTCATGAGATGCCTCCGAAAGGACGACGCGAGCACTTTTTCCATCATTTTATGGAACGCTGCGCTTTTGTTGTCGCTTGCGTCGTCATTGAGTTT
CGGCTGCCTATAGTAAGCAGCTCGCTCTGCTGCTGCTGACGCTGTCATGGGCGACTGATAGACCCACGTGGTGAGGCAGTACCGCGGCATCGTCGCCGGC
ATCACGCGGTGCAGCATCTGCTGGGACGAGAAGAGTACCATGTCTCCAAAACGCGGTGCGATCACGATCTTCTGCTTCGGAAACGGGTACAACACGATTT
CGCCGCCGTCGCCGTCCTGCCACTGGTCGTTCAGGTACAACACGGCAGTGACGCACTTGCCGTCCTCGCCATACGAGTCGAAATGCAGTGGAAAGCAGCC
ACCGTGGCCTTCATTGTACTGCAGCTTGACCATGTAGCCGCTCAAACCTAACCATGCGGGCAATGCGCGCTGCAAGGGCGCAAACACGACCTGGTCGTCG
AAGAACGTGCGCAGCGTCGACACTTGATCGCCGTGGATGGTGTCGAGTGCCAATTCGGTCTCTAGGATGTGGTGCTTCTGCAAAAGCGTCGGCTGCTGCT
CGTTCTTTAGCAAGATGTGGGTCGCATTCGGGTACAACTGGTCTGTGTCGCGTAGCACGGCGATCTGGCGCTTGAGAGCGTGCAGATACGGCTCTGGGAA
CGCATCGCGCACCACAAAGTACCCGTTTTGCAGTAGCGACCGCGTCATCTCTGGCGTCACAGCATGCGGCCACGCACCAGCAGTGTCTTCTTTTGAATGT
GAAGATGCTGTCGATGAGAATGGAGCCGAGCGGAGACGCGCTGGGCGCACGCGCGCAGCGACACGGTGGACGCAGCGTCGCATTTGCTTTCGGCTTGTTT
GATCTCGTCATCTGACACACAATGCATGCAGTGCATGTGGACCACACATCAGCAAGTGCGGAATGATGGTAGCCATCCATCAACCTCATTTGTGCCATGA
CGACGACGATCCGCAATCATGCGGGCCCCTACGTGTACGTTCCGAGCGCCGTCGTGGAGAAGGCGTCGATGCACGACCTCGTGTGAGTGGCTCTGCACTA
GATGCGCCATCATCGCTTACAGTTGAAGAGGCTTGCTGAATGTGTGGAGGTGCCTTGCTTGCTCAAAAAAGGTATGCGGCATGTCCAACGTGCTTTGCAT
CGTTGCATGCATCGCGAATGCCAGCTTCGTCAACTGCAGCAACGGCTGTGAACTGTCCTTCCTGTGGCGCTCGGGTGCTGAATGCGTCCATTGCGTATAA
GTACCGCCTCAAGGTTCGCTTGCTGCTTTGTTCATACAGAGATCATCTAGACTGCTGCTGCCACTGATACAAGTATGCTGGCGGTCACTAGCTCCAAGTC
GCGTATGGACATTGCATCAACGACGCGATCATGTTTGACGAAGTCGCGCAGACGCTTCTTGGGGTTTCCGCGACAAGGCTGCAAAAGGTACTTTCACGAT
GTAAAAATGCGTTCTGTAGGTTCCTTGGTGCAGTAGCTCATTTACGATGTGTGTGTGATTGCATGATCCGATACATAGCTTCAGCTCCAGTACCCTTCGC
TGCCGTGGATCCTCGAAGAGCTACTTCTTGGTCTGCGGATCTCGTTCCACTACCAGAAGGCTGAAGATCGAGCAGCTTCAACTAGCACCAACGGCACTCA
ACGCGCCACATACAATGTACGCACAAGTGTCTTTGTTTTCGTATAATAATGTGTTCGAGCAACTCACGTATTTGCGTGTCATGTAGAGAGACCTCAAGAT
CGTCTCCATTGCGCCGCTGTCGCGCGTGCTGCTGCCAAAGCCGCTCGTGAATCTTGCGATTGAGACTCTGACGCAGGCGCATCTCGAGTCCGCTGCGTCT
TCCTCCTCCTCCGACGATTAACGGTGAAAGCAACGTATGAATCAAGTATGACGCATGTAAATGAAAGATTATATTTACTGGGAGACCGCAGGGAACCCAC
TCTATTCGCAAAAGCCGTGTGCCTATCGTCGCACGATAGCCTTGGATCGCGTTGGCGCGCCGTGCGACTTGCCCCTGATGTTGCCCTTGCCGCGCTTGGA
CTTGTTGCCGCTCGACTGCACTTTGACGCCGCGCGACCGCGCCTTCCGCTTCTCCTCCTTGCGGATCTTGGTCTCGCTCAGCAGCTCGTCCTTCACGTGC
TTGTTCACGCTCGACTTCTTCGCCAGCTGTGGCTTCTTGCCATTGCGGTAATCCAGGCGCTTGCCACCCATGTCGTCGTCGTCCTCTTCGCCGCCGGTGA
ACACGCGCTTGTTTTGGCGCTGCTGCCACTTCTTGTAGATCGCCCCGACCTCTTTTTTCTTGCGCACGTTGACACCACTCTCGTTACGGCGCTTGAGTGT
GCCCTGCGCTGTAAGCTCGCCCGCGGTTGTCTTGACGAACTTCTTCTTGCGTGTGTCCCAGTGCAAGATGCGGCGCTTCTTGTTGAGCTCGATGGCTTCG
TCTGGGTTCACGTCCAAGATGGCTTCCTCCAGACGCGCTTCCTGGAACGAGTTCACCTTGCCACCATCGGCGTTCTTCGCCAAGAACTCCTCCGTCGTGT
GTTCGCCCTCCTTCAGGTACCCAATGTAGTTCTCGCGGTCCACAAAGCTCTTCTTGCTGCTGCCTTCTTCTTCATCTGCTTCCGCGCTGTCGTCCTGGTC
TTCGAGACCAGCAGCTCCGCCTGACGCCTGCTGCTGTTCCTTGGCCACCGCGATCTCCTTCATCACGTCGGCCTCCTTCTCACCGGCTGCGACGCGCTTC
TTGATCTGCTTACGATCGTGCTTCGACAGGAAGAATGTTTTCTTGGACGTCGACGCCTCGGCGGTCTCCACGGCCTTGCTCGCTTCCGCCGCCGCACGAT
TCGCCGCTGCATCCGCCAAGAGCTTACGGAGCGCTTGCTTGTGCTCGTCCAGCTCTTCGGTCGTCTCGTCGCCGTCGTTGTAGACCTTGTCGAGCACGCC
CGTGTGGTCTTTCTCTCCCTTGGTCGCCTCCTTCTTGATGATCTTCTCGTGGAGCTTGCGCTTGCCTTGCATCATGATCACGGCCGCCGAGTTCTTCTTG
GCCGAGTGGGTACCCGACGCAATCTCAAAGATCGTCTGCGGTGGACGGAAGCTCTGCAACGACTCAATGTACTCAACCTTTTCGGCCTTCGAGTCCTCCT
TCATGTACTCCTCCAAGAACAGCGGGTGGATCTTCTTCGCAAAGATCTCCTTCGCACGCTTGATGGACAGCTTGGACGGGTCGGCACGCGTCCGCGTGTA
CGCCTTGTACGCGTTGTCGCACACCTTGACGAGCGGCGAGACTTGTGGGTGGTTCTTGAGCAAGTCGGCCATGTGCTCGGTCTCCTGGTCGATGAGCTCG
TTAGGGAACGCGCCGTAGTGAATGTTCGACACCTGCATCGTGTCGAGCGAGTACGGTTGGATGCCCACAGGGGACGAATCTTCCAGGCGACGGCCGATGT
ACAGGTGGAGATCCACCATAAACGGCAGCTCGTCCGGATCGACAAAGTTGAACGCCGTACCACTGCGACCGGCACGCGCCGCACGGCCAACACGATGCAC
GAATAGCTTGGCTGTCGACGGGAACGAGTAGTTGAGCACGTTGTTCAGCAGCGGGATATCGATACCACGCGCCGCAACATCCGTCACGATCAGCAAATTG
GTCTTCTTGGCGCGGAACTTGCCAATGTTGATCTTGCGAGACGCCTGGTCCATGTCACCGTACACGCACGAGGACTCGATGTGGTTGGCCTTGAGGAGTT
CGTGCAGAAACTCGACGTGGTGGCGCGTGGCCGCGAACACAATCGTCTGCTCGTCCTTGGGGATAAACTCGCGCACCATGTACAGGAACAGCGCGGCCTT
GTCGTTGGAGCGCACGGTGAAGAACGTCATCTTGAGATTCTCCGAGATCTTGTTCTCGACATCCAAACGAATGAGTTCGGGTTCACTCAGACCGGCACGC
GCAAACTGCACCAGCGCCTTGGGCAACGTGGCCGAAAACAGTAGCGTCTGGCGACTCGTAGGCATGTTCTTCAAAATTTCCTGCAGTTGCTCCGCGAACC
CCATTTCGAAAATGCGATCGGCTTCGTCGAACACGACGTACTCCACGACTTTGAGGTTGAAATCGGGGATTTCCTGCAAGTGGTGCATCAGACGACCGGG
CGTCGCGACGATGATGTCCGGGTTCGCGGCGATCGCCTCGAACTGCTGTTCCATGCCTTCACCACCGACGATAAGTGAGATCTTGAGCGTCATGAACTTG
GCGAGCATCTTGGTAAACCGCATGGTCTGTACGGCAAGTTCACGCGTGGGCGACAGGATGAGGGCGCGCACGCCGATCTTCCTCGAGTGCTCTTTCAGCT
TCTCGAGCATCGGGATCAGGAACGCAGCCGTCTTACCGGACCCTGTACGTGCCATGGCCACGACATCCTTACCCGAGAGTACGATGGGCAGCGACTTGCG
CTGGATCGGCGTCGGCACCTTGTAGCCCATGGCCATGACGCCGCGGAACACGAGCGGACTCAGCCCCAGGTGCTGGAAGCCGCCCACACCCGCGCCCTTG
CCATTGCTCTTGCCGTGGGTCGTGCCGCTGGCCGCGGCGCTCGCGGCGTTCTTCTTGGTCTTCTTGAGCAGGTCGTCGGCCGCCATCGCTCTCGCTCGCT
TGCTCGATCGCTGCTAATCAAGGCGAATGGGAGCTGCTTGAGAGCGAAACGTCATGGCGAAAACCATTGGGCGGCAGCAAGTATCGATAATGTCGCACGC
TCATTGGGTAAAAATGCATACCCAAAAAATAAGGTGGTGGACACGCTACTTGGTGTGTTCTACATAATCTTAGGTAAAAAGAATGTTCCCTATTTGAATG
TGAGTCACGTTAGTTAGCGCAGTTTTTCCATTTTGCTCCATAGACACCACCATCATCGTCATAACGGAAGAGGAAAGACGGACGAGCATGTCGCTCGGGA
ATCGACTCGAGCTGGCGCCGCGCGACGACGGCGACGGCAGCAGCGTCGCGCAGGACGAGGGCGAGTGGGCGAGTCGCTTCGAGGACACAGTGGAGACGCT
GGACGCCGCAGTCGCGATCGTGTCCAACGGCGAGCGCGAGTGGGACGCCGCAGCCGGCGCGCAGGTCTCCGTCGCGGCGCACCACCGGAGCGAGAGTGTG
CTCTCGCAGGACAGCAGCAGGTCTGACGCGGCCACGGAGCTTGCGGTGCTGGGCGACACGTGCCCGATCTGCCTCCAGGGCCTTGCGGACTCGGTGATGG
TCCAGTCGTGCTACCACGTGTACTGCTTCGAGTGCCTCAGCATGTGGGTGCAGAGCCTCGCGCTGCACGGTATCGACCCCGCGACGTGCCCGCTGTGCAA
GGCGCAGTTTGACACGATCTACACGAACGTGGTCTCGGAGTTCGAGTACGATCTCTTCCGCTTCCACGGCAGAAACAACAGTCAGTTGGAGACGTCGACG
TCGTCGATCATGCGACGCAGACAGCACAAGGCTCAGAAGGAGCAGCAGAAACTGCAGCGCCGATCGCTCGTGTACCGCAAACGAATGCGCTTAGCCAAAG
TCAATGCCACGCCTGTCGACTTGGATGGTGGTGCATATCCAAAGATCCTCAAGGTCAAAGGCGAGTATGATGTATGGCTGCACCGTGAGCTCCAGGCGTG
TATCGGCCGCGACATTGACCTGACTGTGCTGATCTCGTTGATCCAGTGCTGTCTCGACAAGATGCCTCGCAGTGATCCCACGAAAGGCTACCGCGAGCTG
CACGCCGCACTCCAGCCGTTCTTGTACGAAGACACTGAGATCTTTGTGCGCGAATTCGCATTCTTCCTCGGCTCAAGACTCAATCTGGACGCGTACGATG
GGGTCGTCGAGTATTGCTGCTCAAGTGCAGCGGAATGCACGACGGCATTATGTACTAGTGCACATTAGGACAACACAGAATTATGCATAAGCATGCAATG
TACCATATGAAACACTTGCGGATGAATGGCAAATATACTCGTTTTTTCAGTGTGCTTTGGAAGGGAAATAGCTGTTCCTGTCACGTCCGCCATGCGGCTC
TCTTTTAGCTATGCTGCTACCGTTTCTTTATGCCTTACCCATGACGAGGGCGAGCAGCGCCATGCGCACGTACATGCCGTTCTCCATCTGGCGGAAGTAC
GCGGCGCGCGGGTCCGAGTCGACTTCGAGCGCGATCTCGCCGACGCGCGGCAGCGGGTGCATGACCACCATGTTCTTCTTGGCGTTCGCGATCGTCGCGA
GCGTAATCACGAAGCTGTCCTTCACGGCATTGTACTCGTCCTCGGACTCGAAGCGCTCCTTTTGCACGCGCGTGACGTAGAGCACGTCGCTCTCGTTCAC
CACAGAGTCCAGGTCCGTGGTCTCGTGCTGCGAAATGCCACGCGCAGCCAGCTCCTCGAAAATGGAGCGCGGCATCTTCAAGCTCTCTACAGTTGCAAAA
AAAATAGGTCGGCACGTTTGCATAAATGAAAAGGTGCGCTGGCCTTACCTGGTGCGACGTAGTTGATCTTGACGTTAAAGAGCGCAAGCAGACGCGCGAG
CGAGTGCACCGTGCGGCCGTTCTTGAGGTCGCCGACCATCGTGACCACCTTGCCCGAGAGGTCCAAGCTGCGGCCGAGTTCGTTGTAGATCGTGTACAGA
TCCAAAAGCGCCTGCGTCGGGTGCTCGCCAACGCCATCGCCCGCGTTCAGCACGGGCTTCTTCGTGGCGCTAGCCGCGACTGCGGCACTGCCCTTCACCG
GGTGGCGCAGCACGATCACGTCCGAGTAGCACTCCATGCAACGGATCGTGTCAGCAAGCGTCTCACCCTTCTTGCTGCTGGACGAGCTCTCGTTCACGGG
GACCACCATGCCGCCGAGACGGAGCATCGCCGCCTGGAACGAGCAGCTCGTGCGCGTCGACGGCTCAAAGAACACGTTCGCGAGCAGCTACAGTAGCGCA
TTCACAGCGTCCGAGTCAGCTCCATACACAAAGTCACCCATGAGCGCATATCGCAATGCAAAGAGAGACCTACTTTTCCCTTGAGGAGGTCGCACGCGCC
TTGGCTTTTCACGATCGCGCGCATCTCATCGGCGACTTGGAGGACGCGTCTGCGGACAAGCAAAGCGATCTTTAGCGTTCTCACACCATATTTTCACAGC
CAGCGCAGGCACACAGGCACGGGACTCACTTGGCGCTTTCGACGCCGAACTGCTCGATGGAGAGGATGTTCTCGCCCTCCCAGGATCCCTTTGTGGTCTT
CGCGTCGAGTGTCATGTTGCTGCTACTGCCTCGGTTCTGCGGTTGCGATGTCGAAGTGTCGGCCACGCTTCAATGGTCCAGTGGACATGTGCCGCTTTAT
TATTTAGACCATGTCGCTTATTTGCCTCTATATATCCTAGTTATATGTACTTGGTAAAGTCTAAAACCTCTCTTTGAACGGTAATGTATGCCTGCATCTG
TAGTGCGCATTATTCAAGGGGTTACCACTGCACGTCTCACATAATGGATCAACCTGTATAACTTGATGCACCTTCCCCTTCCATAAGTTCGCTTTCCACC
TTCGTGCAACATGCCGCGGGTAGCGCACCGTAACGCGTCGATAAAGTGCGAGTTTCCAAACTTCTGGTCTGCGGCGTCTGCGCACTTTATCCGTCGCGCG
CCTTAAAGCCCAAGCAAGGATCAGCATGAGCGAGGACAGCGCCAAGAAGATGAAGCAGGGCGCGGGCAAGCGCCTGAACGATAAGCAGCGCGTGGAGATC
ATCCAGATCTCCGAGAACTCCAAGATCTCTAAGCGCCAGCTGGCCGACAAGTACGGCGTGAGCGAGGCGGCCATCCGCAAGCTGCTGCTCAAGAAGGACG
ACTTCCTCAAGCGGTACTACGACACGCCCGAGGAGATCCGCGACCAGCGCCTGCGCGGCAAGAACCTTTCGATGGGCGACGCCGCCGACGGCACCAGCGC
GGCTGGCGAGGCTGGGGAGTACACGCGCGCTGCTGGCGCAGGCAGCCACGCTACGGGCACCGCGCATGCAAAGAGTCTGTACCCTTCGGACGATCCGTGG
AAGCAGGGGCTTCATGCACTCGCTGGCAAAGTGACTCCATTTCTCAAGCATTTCGTACAAGCCAAGCCTGTACGCGATGCCACGGCCGTCGCTGCAGCGA
TCGCAGCCGCTGGAGATGTATTAGTAGGCGATCAAACACTACCGACGGCTGCGGTGGAAGACCCAATTGCGGCTGCTGCTGCGCAGGCAGCAGCTGTCGA
CTGGATTGGATTTTCACGCATGCTTCGTGATATCCGTCGCGCATTCCACCGGTACCCGGAGCTCGGTTACCAGGAGGTGCGCACACAGTCGTTCATCAAG
CGCTTCTGCGAGACAACTCTGCGGATCCCAGGCAAAAATATCCAAACAATTGCAGTTACGGGGCTGATCGTCGATGTTTGTTTTGAGAACGCGACGATCC
CATCCAGCGACAAGCGGAAGCTTCCTGTGTTGGCATTCCGTGCCGATATGGACGCTCTCCCCATCGAAGAGCTCAACGATCACTTGCCATACGTTTCGAC
GCAGAAGAAACAGCGCAAGGAACTGCGGAAACGGAAGAAGCGAAAGAGTATGAGTGGAAACGCCGTGGCCACGCCCGTCAAGCCGACTGATGAAACACAG
GTTGCTCTTCCAGATGAAGCCGGGCTTGCGACGCTTACGTCTCGTTCCATTAACGGAGAAGACGCAAGAGACGCGACTGCGGACCTCGAAGTGGAAACGC
CATCCTCCCCTACTCCAGTCGGCGCCGACGGCGATGACTTCGAGAGCGACGTGCCAGGTGTGTTCCCTGCGGCGGCACACATGTGCGGCCATGATGGTCA
CATGGTGATGGTGCTGGGACTCTGTGCGCTGGTGGTGCGCAACGCGCACTTGCTGCCACAAGACACGTTTGTGCGCTTCATTTTCCAGCCAGCTGAGGAA
GGACCAGGTGGTGCCAAGAAGATGATCGAAGAAGGAGCGTTAGAAGGCGTGGATGAAGTCTACGGCCTGCACAACTACCCGTTCCCACTGTACAGCGTGC
ACATGCGTCCAGGACCAGTGATGGCTCACGAGGTGGAGTTTTCCATCGACATTCACGGTGTTGGTGGCCATGGATCGGCGCCGCAACAGTGTGTGGACCC
GATCTTGGCGGGCTCGATGGTCGTCCAGGCGCTGCAGAGTATTGTAAGCCGCTCGCTATCCCCCACAGACACGGCGGTCGTATCAGTCACGCAGTTTCGA
GGCGGAGATACCAACAACGTGATCCCCAGTCACGTCTTCCTTGGCGGCACCATCCGCGATTTTGACTTGGAAGTCGCCGAGAAGATCAAGGCGCGGATGG
AGGCCATCGTCCACTCGACGTGCGCAGCGCATGGTGCGACGGCGCAGGTGCACTTCTCGGACGGGTACGCGCCCGTGATCAATCCGTACGAAGAAACGCG
GAACGTGCAGCAAGTGGCCATGGACATTGGTCTCTACGTGAGCGAACAGGGGCTCCCGCTCATGGCTGCGGAGGATTTCTCGTACTACCTGCAAGAACGG
AAAGGCTGTTTTTTCTTCTTGGGCACGAAAGAAGACGCGGATGACGACAAGACGCGCGCGCTGCACTCGAACCAATACGACTTCAACGACAAGGCCATTC
CGTTGGGTATTCGCTTGTTCCTTGGGATCTTGCAGTCGCGGTTCCAGTGCGAATTGTACTCGGTCGAGGAGCTCCAGGCGTTCCAAGTCGCCATGGAGCG
CATCG