Description :
From Genome Similarity Track
Location :
Scaffold_18:647260- 651371
Transcript NameFunction/comments
Physo_132016reverse transcriptase

Sequence
4111 bases(100 bases per row)
TTCATAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACGGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGT
TCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTAC
AGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTGGGAGT
GGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTT
CGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCACAAGCAC
AAGCTCTATGCGAACCTGAAGAAGTGCATCTTTGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGCGTCCGCCCTGACCCTGAGA
AGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAATGACTA
CGCGGGCATGATACACCCGCTGTCACAGCTCCTGAAGAAGGACTCCGAGTGGATTTGGACTGCTGAGTGTTAGCAGGCCTTCGATGCAGTCAAGCGGGGC
TTGACTGAGGCGCCGATCTTGGCTGTGGCCGACCAAGATCGCCCATTCCACGGTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGC
ACGATCACGAGAGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACTCCTTGCCAT
GAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTGGTGGTCTCTACGGACCACGCGTCACTACGGACGGCTGTGAAGTCGCCG
CACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGTAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGC
TCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAA
GATCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTTAGAAGTTGCCGAAGCATCTTCGTGCT
CGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTATAATGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAACGACCATGACCTGCGAC
TTAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCA
GTACAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCCTCCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCA
CGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTAGTCTTTGTTGACCGCTTCAGCA
AGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCAAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGA
CATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCG
CAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGG
CGGAGTTCGCCATCAATAACTCGGTGCATGCCTCGACCGGGCATACGCCGTTCTACGTGAATGCCATCAGGCACTCACGCCTCCCGAGTCTACTCGGGAT
GGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAC
AAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGA
ACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAATTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCTTTCGGTTTGTCCA
AGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTTAAGATGGGTTCATTGGTTTTGTTA
GCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCA
ACGCCTACACGCTAGATATTCCATCTAGCATGCGCCACCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGC
TGGCCCGAAGCGGAAGCCCCAGCGGGAGCGGACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGT
CCGACGCGGTCTGCGAGGCCTGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGTGAACTCCCGGCTCTGATGCTGTTCCACAGCAGC
GACCCGCTCCTCGAGCGTCGGGCCAAGGTCTACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCTCGCGGCTC
AACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCAGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCAC
CAAGATACATGGGAGCCAATGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGTGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCG
AGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCACGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGA
ATCGTCGTGTACCCGTTTTGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCCTCGGGCACAGCGCATGGAATACCAG
CGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCCCGCGTCGAGAATGTCTCGAAGCGCTCACGGGCGTGCTTAACACGCTCACGGTAAGCAGCCGG
CTTCTTGTTGAAATTCTCAACAAAAGCATTCCAACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGCTCGTGAAAGAGTCCGATATAGT
AATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGGATCCCGCTGCATACGTACAGCGAAATTTCATTTGGAGG
CACGGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAACTTGAAGACGCCACCTCA
CGCGGGGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTTTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGC
GTCTCGACCCGCATGCCGGGTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGCTGGAAGAGGCCTCGCCCTCTTCCATCTCTACGTCGTCACTCCC
ATAGTCAACGG