Description :
From Genome Similarity Track
Location :
Scaffold_17:647044- 650085
Transcript NameFunction/comments
Hyaar_Emoy2803157hypothetical protein

Sequence
3041 bases(100 bases per row)
AGACGACCGACTATCGGAGGGGGTACTCCGTCTCCGTGCCTTGTATTTTCTTCCTCATCTTGTGTACCCGTCGGTAGGGCGGGATGCACTCTTCTTGGTG
GACTCGTGTCGATAGAAAACTTGGCGGTGTTGGGAATGGGGTTTGTGATCGCGCGGAAACCTTCACACGATCACGGGTATACTTGTGGGTTACTTGATGT
AAGCCACCTAGATCTCAACGAGATCGCCTTGTTCACTATGTGGATGCTTGATACGCGAGCCTTCTGACTACTTGAGCCGTCTCGCGATCTTGCGCCTTGT
CCTTTACGTTCTTGCTGCATTCAATCGCAGTTGGGGTTGTCTTGAGAGTTCTTGATCCCCAGCCAATTATCTGGGGATATCACTTGGTTTCAGTATGCGC
GGCTTTCTTGACGTCAGGAGGCCAATATTCCAGCCCGGAAGAGAAGTCGACACGTGTACATAAAAGCAAATAGAATTCTGTTTAATGTCAACCAACCAAA
AGCTAAAAATACGAATATGCCTGTCTATATGCCAGGATATGCTGCCACGTGTCCTCTACATTCCGTTGATCGTTACTTCGCACATGTGGTCCACTTCCGA
TGATAGATCATCGATCTCCTTGACTGATCGTCGATCTCCTTGACCGATCGTCTATCTCCTCGGTCGTCTATCCACTTGATCGTCGATTACTCTCCAGGAC
CTTGATTCCTGCCGATTTGTCGGTCATCTTCCCGACTTTGAACACCTTATGTGTTCCCGATCTTGGTATCTTGCCTCGATCTTGGCAACTTGATGTTCGA
TCCCGTTGCTGTGATATTTGATCGCGGTATTGCGATATTCACTCTCGGTATCGCGGTATTTGATCTTGTTATTGCGATATTCGGTCTTGGTATTGCGCAG
CTTAACAGCCAATCGATCCTTCTCAATGAACTGTCGCGGTTTGAGATCACTCCACCCAACGATCGCCCCCGATTGCTTCAATCCGCTTTACGACAGCCGT
CCCCTGCACTAATAACCGACATACAGATTTGGTGTATCTGTGCACTGCATCAGCGGTAATCTCTATCTCCGTAGATCTGCTTGTACGCGTTGTTCTTCAT
GGACGACTCTGGTGATCAGTTGATCACCTGCCCAGGTCCACTGGAAGCTTCAGGCTCTTCCCCACCGGTCACAGCGCCCCCACGTTCTTCTGGTGATCAA
TCGATCACCTGCCCGGGCCTGCCTGAATCTTCAAGCTCCTCGCCACCGGCTGCAGTCCCTTTACGTTCGTCGTCTTTGTTTCCGAGAGGCAGCGTGACCT
TTCTCCCTGCGATCGATCGGCGTACCCTACGATCGTATATCGACGATCTCTACGACTACGCTGAGGCCCGTCAATATCAGCTAACCAATTACAGTGCGAT
CCACGATCAGTTGAGAGCTCAAGCAATTCGCGGCGATCGCTTGGAACGTCAACTGCGCGACAATCAAGAATTCGCAGGACCGATCCGGCTATTTGTGAAC
AAGCAGTACAACAATCTGCGTGACTCGTTGGCTGATGCCGAACAGAAAATCGCTGGATTTCAAGAGGAATTGGCTGATCAAGAGGAACGTCTACAAGAGA
TTCCAATCCTGAAGTCTTCCCTCCTATAGCTTAAAGCAGCCCGCCATGCCTAACAAGAGAAGCATCGGCGTCAACTGGCTATACTCCAAAATGAGTTGGA
ATCAGCGATTACGTCTTCCAAGGATGCCGATGATCAGGCGAAGCTCCAGATCGAAAACGCGAAAACCCGATTTGCCGCCCGCCAGTCTGCGATCATGCGG
GAGTTAGCCATGGCCCAGCTAAACTTGGGTACAATCAAGACTGACCGCGATCTCTTTGCAGCTCAGATTTCAGATCTAACGACTCAGCGCGTTCGGCTAA
ACTTGGATCTCGCCGATCGAGATGCCGATCGTGGTCGGTTAGTGAAGAAAATGGGTGAGTTGAAGGTAGAGCGCGATCAGGCACTCCAGTGGAAAGATTC
GCTCTTCACTCGCATGGCTGAAGTAGTCTCCAGTGCCACTCCAAGTGCTCTGCCTGAGCCTTCTGCGCCTCCCCGGAAATTCCCCCGCTTCGACACAAGC
GATCGCCCCCCCCAACTCCAAGTCCGGGAAACCGAAAACCAAGCGTGTCCGTCGTACCAGATTGTCGCCGGGTAGATCGGATTCTCCTGATCCGTTTGGT
TCTCGATCTCCATCGCCAGAGCGATCGGATGGCAGCGATCAAGTTGATTCTTCTACTGCTGATACCGATGATTCTCTGCTGGCGGCATTATCGTCGTCCC
GTTCTGCCACCCGACGTGGAACTGCATCGCCTTCCAAGAAACCATCGCCTGCTCCGAATTCTCCAACGATCAGCGTCGATTCCCCCAGTCCGGAACACCA
ACCTCACGGTAGTCCCTCGCGAATATCCATGGCAATTTATTTGGAGAGCCTTTAAGCGACTCTGAAGGTGACCTCAGCCTCTCTAGTGATTCTCGGAGTC
CCTGTAATTCACTGCTGACTCCTGAAGAATTTTCGGCACTTCCTGACACCCACATACCTCGCGATCGTTGGATCCCGGGGTATCGCGATCGGGTTCCGCG
ATCGGCAGTAGATGTGTCCCCCTTGGTCCGCCTGGATAGTGAGCTTGATCAGAGTATCGGAGCTGGACATAGAATTGTTCTATCATCACTTTTCAAATCC
CAAGGGATACATCTTCCCGATCCAACTGGGCAAAGTTCGCCCTCCTCCAGAGTCGTATGGTCATCCCAGTCGATCACGTCGACCAAGATTGATTAATTTT
ACGATCAACAACCTTGGGACCTTGATGATCACACCACACACCCGATCTCCTTCAAGCCTTCCGGCTGGTTCGAAAAACTGGTCGAGGCGTATGAAGGTTT
CGTGGATAGACATCGCCAAGCTCTGTGGGAATTGACCCATTTCTTGTGGATCTCCGCTGAGCAGCGTAAAACGGATCCTGGATTGGCCGCTTTTGCGCGA
GCGAGAAAGCAGACACGATCTCGTGCAGGCCCCCGTTGGAA