Description :
From Genome Similarity Track
Location :
Scaffold_1649:6470- 8023
Transcript NameFunction/comments
Phyta_totarag13425hypothetical protein

Sequence
1553 bases(100 bases per row)
GGTGTGGTCTGCGACCTGGACGAAGGAAATGCACGTCCAGTGTCTCAACGCGCAAGACAAATTGCCCCACATTTGTTGGTCATGGTTTACGAGTTACTCA
AGAAACTCCTGGAGACCGGTTTGATTGAGCTTTCTGAATCGGAGTGGGCTTCACCAATTGTGATCGTGCTCAAGAAACATGGAGTGGATATCAGGATGTG
TATTGACTACCGAGTGGTGAATGAGTTCATTAAGTTGCACGTTACCCGTTACCGTTGATCGATGATCTGCTGATCGGGTTCGAGTCTGCGATGTGGTTCA
TGAGTCTGGACATGGCCAGCGGTTTCTGGGCAGTGCTCATGACTGAACGCGCCAAGCTGATCTCGGCGTTTGTTTGTCTGTTTGGACACTTCCAGTGGAT
CCGAATGCAGTTTGGGCTCATGAACGCGCCGCTTGTTTACCAAGAAGTGATAAACAACTGCTTGTGGGGATTTGTGAGATTACCGCCCGAGGGAAAAGCT
CTAGTTGACCAAGATGTCTTGGAAGTTTTGGAATTGAACACACCGGATCCTGAACGCATAAATGTTCAAGATCCCGAACGCACATGCGTTGAGGGTTTTG
AACATGGTGTGGCTAAGCCCCTGATTTTGTCCGAAGAGATGACAGTTTTCAAGCGTAATATTCCGTCGCATCCACAAATGGGGCCAGTGCTTGGACGCAG
CTCATATATTGACGACATTGCGTATGGCCCGCCGACGTGGGATCAGCTGTGCAAGCATCTGAAAGCACTTTTATTCAGGTTGAGATATTGGAACATTTCA
GTGAGTCTCCCAAAGAGTGAGTTTGGCAAACTGACCATTCCGTACCATTCGCACGAGATCAACGCTGAAGGAATCCGAGCTACGCCGAAGATAGCGAAGA
GCGTTCAATACTTACCGTTTCCGTCCACGCTCAAGGGAGTCCAGTCTTTCTTGGGGAGCTTGAAATACTACAATAAGTTCATTGAAGACCTCCTTGtgat
tgctgctgtacaCTATGAGTTGAATGATGAACAAGTGCGTTCAGGCCGGGATCTTGCTAGAGCCAAGAAAGCGTTTGAGATTTTGAAGCGGAAATTTGTT
TCAACACCGTTGCTACGACACCCTGATCGCACACGGCAGTTTATCATCGTACCGCATGCCAATCCCTGGGCCGCTTGTGCAGTTTTGGGTCAGATGTACG
ATGGTATGATTCAGCCAGTTTGATTCACTGGACGCATCTTGAACGAGTACGAGCTGCGGTACCGCATTGCCGAGAAGGAAGTGTTGGCGATACTACGGGT
CTTGGAACTAATTAGACCGCTAATCTACGGTTCAGAGTACCTCATCGTGATGTACACTCGCTATTCGGTACTGAGAtggttgttgaagtcgaacGCCGCA
GATGGTCGGTGTCTCAAGTGGGGTTTGGAGCTGTCAAGGTGGTCGTTGGAGCTTCGCCAAGTTCAGCATAACGAAGGTGGTCCGGCCGCAATTTTAGGTG
CTAACATCACCCCCCGGGAACTTTTGGATGCAGTCGCTGAAGGGTTGATTCCG