Description :
From Genome Similarity Track
Location :
Scaffold_1969:647- 4736
Transcript NameFunction/comments
Phyag_g11825ATP-binding Cassette (ABC) Superfamily

Sequence
4089 bases(100 bases per row)
ACACGGTTGTTGGGGACAACATGGTGCGTGGTGTGTCGGGTGGAGAGAAAAAGCGTGTGACGATGGGCGAGATGGTGCTCGGCATGCAGCGTGCTGTATT
CATGGACGAAATCAGCACTGGACTTGACAGCGCTGCCACTTTCGACATTGTCAGCACGCAGCGTACTATCGCACGAACGCTGGGCAAAACCATGGTCATC
TCCTTGTTGCAGCCACCGCCAGACGTGTTTGCACTGTTTGACGACGTCATTCTCTTGAACGAAGGTGAAATACTGTACTACGGACCTCGAGAAAAAATCG
TCGAGTACTTTCGCGAGTTGGGCCTCCACTGCCCTCCAAATCGAGACATCGCCGACTTTTTGCTCGACCTCAGCACTCCGCAGCAGTTCGTGTATGAGTC
CACAGCAATTGGTGCAACGAAGCCTCCGCGTCTACCAAGTGAGTACGCGGAAATATTTCGCTCTTCCGATATTCACCTGAGCGTTCTGGACCATTTGAAC
GAAAAGGTGGACCATAGCAGTCTAGACAAGTGGAGCAAGTACGCCAAGGCTATTCCGAAATTCCAGCGATCGGTATGGGCAAACACGCTTACGCTGGTGA
TGCGACAGCTGATGCTCATCATGCGCGATGCGAATACGCTTCGCAGCCGCATTGTCCTCGTTTTagtggtggccgtggtgTGCTCGACTGCATTCATGGA
CGTGGACCCCACCAACGTGCCGTTGGTGCTCGGAACGATCTTCATGTCAGCAATGTTCCCCCTCTTCGAGCAGACCTCACAGTTGTCGATGTTTGTTGGC
ATGCGCAATATTTTTTACAAGCAGCGCTCagccaacttcttccagaCGTCGGCGTATGTGCTCGCCAATGTCATCAGTCAAGTCCCGGTGGCGCTGCCCG
AGATTTTCGTTTATGGAGCTTTCATGTATTGGATCGCTGGATTGGAGGCAGACGTCGGGTGCTTCATTTTGTACGAACTGATCATCTTCCTCACCGTGAT
GGCGGccgtcctcatcttcttttTCGTTGCTGCGATCTCTCCGAACATGTACACCACGAATCCACTGGCGCTGGGCATCCTCCAAGTCGTGTTGGTTTTC
GCAGGCTTTGTTGTCACGAGAAGCCAAATCCCTGACTACTTGATCTGGTTGTATTGGCTTGATCCGATGGCGTGGGCTTTTCGGGCACTCGCTGTGAACC
AGTACAGGTCTGCAACGTTCGATGTATGCATGTACAAGGATATCAACTACTGCGACCAGTTCGGCAAGACCATGGGCGAGTACTACCTGAGCGTGTACGA
TATTCCGTCGGAGAAGAAGTGGGTggtctttggaattatctATCTCATTGGATTGAGCCTCCTGTTCATGGTTCTGAGCTACTTTGCACTTGAGTACAAG
CGGTACGAAGGCGACTTCAGAGCTATTCGAGTTACATCGTCCGAAGACGATTTAGACAACTATCAACTTGCCACGACCCCCAAGACAGACAACCACGCTA
CCCCATTCAACTCAGCCGACAGTACTGTATCTATCGAGGTTCGAGAGCACTCACGTGCATTCGTGCCGGTCACGGTGGCGTTCAAGGACTTGTGGTACTC
GGTGCCAGATCCGAGCAAGCCGACAGAATCAATCGACTTGCTAAAAGGGATCAGCGGTGTAGCTCGACCAGGGACAATCACTGCACTCATGGGTTCCTCA
GGTGCAGGTAAAACGACTCTCATGGACGTCATCGCTGGTCGCAAGAATACTGGGTCTGTCCGAGGCAAAATCTTGCTAAATGGCCACGAAGCTACCGAGC
TCGCCATTCGAAGATGCACGGGGTACTGCGAGCAAACGGATATTCACTCCGAAACCGCGACGTTCCGCGAGGCGCTCACATTCAGTGCATTCCTTCGGCA
GGACAGTGACGTCCCCGAGAGTGCCAAGATCGCCTCTGTGAACGAAATTGTGAACTTGTTGGGACTTGGAGACATCGCAGATCACATGGTGCGTGGGAGC
TCTTtggagcagctgaagagaCTGACGATTGGTGTGGAGCTGGCTGCCCAGCCTAGCGTGCTGTTCCTTGACGAACCAACGAGTGGGTTAGACGCTCGGT
TTGCGAAGATGATCATGGATGGTATCCGCAAGGTCGCGGACTCTGGACGGACCGTCATCTGCACGATTCACCAGCCGTCGTACGAAGTTTTCAGAGTTTT
CGACAACCTGCTTCTGCTCAAGCGAGGTGGCGAGACAGTGTTTTTCGGTGAACTAGGCGAAGATTGTCGGGCGTTAGTTGACTACTTTGAGGCAATTCCT
GGCGTGCCACCACTACCTGAAGCGTACAACCCAGCCACGTGGATGCTCGAATGCATCGGCGCTGGGGTGAACAAGTCGTCTCAGGAAAATGCTGTGGATT
TTGTCCGGCGATTCAGTGAGAGCACGCTCGCAGTACATTTGGGCGCAGTTTTACAGGAAGAAGGTGTTGGGCGGCCTTCACCTCACATTCCAGCGCTGGC
ATTCGGTCGAAAGcgagcggcgtcttcaaTGGTGCAAATGAAGCTGTTGACCCAACGCTTCTTCAATATGTACTGGCGCACCCCTGCGCACTACATCACG
ATTCTTGGGGTGGCACTGGGAAGTGTACTAGTATTGGGACTTGTCGGCAGTGGCTTGTCGATGACTTCGTACCAAGGGATCTGTTCAGGACTCGGCATCA
TTTTCGTCGCGTTCCAGTTCCAAGGCTTTGTGTCTTTTAACAGCGCAATCCCTTTCGCCTTCGACGACCGAGCAGCGTTCTACCGTGAGCGCTCAGCACA
AACTTACAGTGCGTTGTGGTATTTTGTTGCTCAAACACTCGTGGAGGTCCCGTATGTCTTCACGAAAGGTCTCATCATCTCGGCGCTTCTCTTCGCCTTC
ATGGGCTTCACGGGTGTTGCCAAGTTCCTATTGTTCTGGCTGGCGGTATCGCTCTCTGTGCTGATCGACGTATACACTGGACACCTCCTTGCTTTCGCGC
TCCCGAACATCGTCATGGCGTCGCTCACCGGCTCCGTTGtgtccaccatcttcttcctaTTCGTCGGTTTCAATCCCCCGGGGAGTTCCATCTCTGCTGG
GTACCAGTGGCTCTACACAATCACCCCCCAGCGCTATGCAATGTCGATCCTCTCTACGCTGGTGTATGGCGAATGCTCCACAACGCCCGAGCTAGACGCT
GCCACGGGCGTCTACATGAATGTCGGCCCGGAGATTGGGTGCCAGCCACTGGAAGACGCACCCGTGTCGATTGGAAACGTGACGGTGAAAGggctgctgg
aagacgtgTACAACATGCACCATGACGATATTGCACGCGATTTTGGCGCGCTACTCGTGTTCATCATCGTTTTCCGAGTGCTATctctgctggcgctgca
gttcctcaACTACCAGAAACGGTAGacggacaacttcaacgatGCCAATACTAATAGTTTCGTTTCGTTTTCACTGAGGTATCACTTTGATTTCGAGGAA
TTGCCTGATCTAAGTGAACATCTACTTATTCGCATTTAGATGCACCGCCGCTCGACACGAATAATTGGTGTTGCTATTTCAGATTTTACTAAGTTCGCGA
ACCTTGTAAATTGAGCCACCAAATATGAACGACTATAAAATAGTCCGATCAGAATAGCTTCAACCTGTCTTACTTTGGAGACGCCTTCAGTATCTCACCC
CTTAGTTGACCGATCTATTTATTTGTGCTAGTAGCTTCGGAACTACAACCGAGATCACTCTCCaattttcttcatctcaAGCGGCCTCTTTCAGCCTGTA
CTCGGCCAGAACAACCATGTCGACTGACAACCCACCATCGCCTAGCCATCCCTACGGAAGTGTGCCCTTTGCGCTTGACCATGAACATGCCAAGCATGCA
GTCAAGATGGAGTGCCCATTTTTCATCAGTATGTCTGGCGCCGACGGTGCATGGAAGCTGACCAAGGCAAATTTTAGCCACAACCACGCGTTGTATGCCG
GGTTCACGACTGCCAATGCGCAGAGCGATCGGCAACAGAAGCGGCCACAGCTCTCCggaacacgacgacgcaaACAGCCGACATGGTGT