Description :
From Genome Similarity Track
Location :
Scaffold_1270:647- 4413
Sequence
3766 bases(100 bases per row)
AGTAATAGTCTCTTGTCGCTGACGCTCGTGACCTGGAGGTATTGTGATCGACCGGGTCCCAGGATTGCGGTAGGCACCCATTTCCCGCCCCGAATGACCC
ACCGTTTCTCATATTCCATCCACTTTAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCGT
CGCCCCATACAACGGTCGCCGTTCACTGAGCTGGACCCGGATCTCGTCAGGGAAACAAAGTGTCCCATTCGCCAGATCCAACCTCACTCCGGCTGGTACC
ATGAAGTCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTACACCAAACAACCTGCCAACGTGATCTTGATCCGCG
TTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATC
CGGTATAGACACCTCGGCACCACAATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTAGTCTGAACCACTTTCCTGGGGCA
TGGTACTTCCAGTATACACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCATGGGTGGAT
CTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGA
GACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACCAGAAAACTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTC
CTCCTACCTGGATCTAGCGATATCTTGTTCACAAATGCATAAATGCAATATCTAGAACGCTCGGCTCGTACCGGTTTCAAACCCAGCAAGCGTCCTAGTT
TAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGAGGATCTGGTTGTAGAATTTCTCCATCGGACACTTGCCG
ACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCATAGACCAGATGTTTCCAGCATC
CAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTAC
GGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGCTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGAACCG
TCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATC
CGACCGCCGCCTTCTTCTGGCGGTGTTTCGAGTTCATCTGCGTCTGGAAGGCGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGA
TGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGGCCCGTAGACCGGCCACATTTAGTCGATTTAGGTATTCTA
GCGGGGATTCATCCGATCTGCGGCAAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCAGAGTACTTGGTCTGGAAGCTGCGCAGCAAATCTGG
CCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAATTTCTGGCTGGCCCCGCTAGCAGATCTGCAAAAGTCAGACACTTCTCGGCACCTGACGCT
TGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTG
AGATCCGTACCCTCTGGATCATGGACGATCCACATGCCCCGGCTGCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGGCCATCCAGATCATCTGGGTC
GAACTCATCATGGGAGTTGTCTTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGAACTTGGCCGTCTGGTCCACTGGCGAGTCAG
GATCTGTGCGGCGATTACCTTGAGCCCGATCTGACGATAACTCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGT
AGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCCCGGATTCTCACCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTC
ATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCTTCCGCCGCAGATTCGTAGTTCGAGGACACAGCTTGGCTGATCCTCGGTGACGACACTGGATCCA
TAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGTGGATACTATGAGGTCCAAGTCCAGCTCGAAGATATCCTCTGC
GTCGAACACACCAGCAACGATGCCTGACTCCGTAAGCAAAACGTAATAGATCCTTGACTGCCACCAACTTGTTTGCCGTTTTTCGTTGGTGCTCTCACCG
GTTCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTCATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGA
TCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTC
TCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAGCCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGT
TAGCGGTTCTTGACTTGCGTCAAGATCCGCAGGGGTCTTCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGAACCGGATCCGGATCCACCTCC
CTTCCGTCGACAGAGTTCCCCCAAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGTAGCGTCTTCGTCGATCCAACCTCCGACGACGCCTCTTCCC
CTGGCTCAATCTTCACTTGAGCATCTTCTTGTGACTCACGGTGAAATCTTGAGTCACCAGAAGATCCGGACACGCGCACCATTGTGGTGTAGCTGGATCA
GCAAAATCTGCGAGATTGCAGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTTCT
CACCTTGCGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGATCAATTGAGTGTCTTGGGGATGGGGTGGAGCAGCAGTGGAAAA
TCTTTACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGC
GGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTTCTGGGACGGGATCTTGAGAGTTGAGAACCTCTAGGGTGTAAGTAAATTCG
ATTAACCTGTCGGATCTGCACGTGTATCAGAAAGCTCACGAGGTTGTAGGGTCTGGCCAATGTATT