Description :
From Genome Similarity Track
Location :
Scaffold_933:647- 4365
Sequence
3718 bases(100 bases per row)
TTCACTCCTTCCTCCTAATCCACATTTCTCCTGTGGATTTGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCTGCGATCCTCCTCCCGATCCACAC
CCCTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATAACCAACTCATATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATC
TGTTCCGATTCGTACGATCCCGCAAGAAGTCATAGCGTAATGCTCCACAGTTCAGATCTGTCTCGTCTACCCAGCTGGGCACGTCATATTCACGCCAATA
CACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACA
TTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGGTTTGCGGCCGGTCCGGACATTGCCTGACCA
ACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACCGCATGTTCCCCTATCTTTTCGCTCACCCGGAA
CGATCCGTGCCATAGAGGGACCAATTTGCGGGCGTACTCTTCCTTCACCCGATCTAAATATAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGG
GCGTCTCCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGATAGTATTTCTGGACTTGGTATC
GCCATCGTCTTGGATTTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGG
GGTATCGCCTCGGATCCTGTCCTGGGCGATGTTCATTGCGAAGGTGAGTCGTTCTGCGTACGCATCCCAATCCCTCTGATCCAAATCCTGGACATACATC
TTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGT
TGAAGGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCCCCAAATCTTCGATAAACGCACTCCTCGTACGATTC
GGCAATGGTTTATGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAGATCAACAATTATGTGTTTCCTTTGAACGAC
TTGGGCAACCAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCGGGTGACTCCCCTTCGACTGTGGGCCTGCCCTTGC
CTGTCTCACAATCCACACATTCACCGACATTGTACGCTCTTGAATAGTCCCCTCCAGTAGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATTCCCT
GATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAGGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTTGTTGAC
TCTCTTCGTAGGGGGACAATAGAAGAGTAAGTCATTCAGACCCACTGCATAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCT
CGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACCCCCTTCACAAATGTTT
CATCGAGAATCTGGGGGCTGGATCCAATCTTCCATCTGAATCTAGTGACAGCCATTACCTGGACTGTCCTTTTGACGGATCCACCCACTACCACTTCGTC
TAGTCGGTTTAACGTGACGAGATCATGACGCTCGGCCTCTCTCTCCACCTCCACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTG
GCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTCAGGGCCGGGGCCTTGC
AGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAG
GAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTG
TATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTTGTACCGTCGGGGTAGGGATCTGGATCCGGC
GTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTTGAGGTGTGATGATCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCC
TTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAAGCTAGC
GTAGAGTGTCGAGTCAGGATCCGGACGGATCTTCCCACCAGCAGGTTGTAATTGAGATCTAACACGCGCAGGAGCGCGAGTATCCCCTTCTCCACCGCTC
CGTAATTCAGTTCATTTGGCTTCAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCGGCTGAGACTGCCCAGTC
ACTGGCATAAACTATCACCGTAAATTGACGTTCCGGATCGAAATGGCGGAGGATGGGCGTCGTCACGATCTTGTTCCTTTGTTCCACGAACGCGTGCTGA
GCTCGGATTCACCGAGGTTCCACCTTTTCCGAGCTCTGATCCGTCGTCTCTATCCAGATTGGATCCTCTTTCCCTTGGTCACGGGGTGGATCCAGCTCCT
GTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGGGATCTCTAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCCGAATT
GGCCCTCGCAGCAAAATCCACCTCCCTCAATTCATAGAGTACTGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGCTCAAACTGTCCAAG
AAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCTGCAAACGAAGACAGGTCCTTAGGATCCGCCTCCAGTCCCTCCTTGGAGACTCGATGAC
CTAAGTAATCCGCCTTGCGCATCCGTCAATAGCTCTTCATCGCGCTGATAGAGATATTCCACTTAGGACACGCCTCCAGTAGGGATGTCACTCTTTCGCA
CAACTGATCCCACGATTTCGCCGGGATCAGAATGTCGTCGATATAGGATCTGCGTCCTAACACGGATAGAGTCCCGCATCCCCTGACTATCCTGCTTTGA
ATGGATCCAATTCCGTATGATCTTCCCCCTGCTCCACCTCTTTCGGGTTCTGGTATTCGGGTGAATCCGTAGAGGGCATTATCGATCAGGCGTTGATAGA
TCTGGGGCGCATTCTTCAATCCGAACGGCATCCGGCTCCATTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGT
CACCACCCAGAAACCACT