Description :
From Genome Similarity Track
Location :
Scaffold_835:647- 2159
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_835-fgenesh-gene-0.1Intraflagellar Transport Protein 140

Sequence
1512 bases(100 bases per row)
ATCGCCCGCTCGCACGGCCTCGTCGATCCCAGGCTCCTCCAGCAGCTTCAGGATCGCGTCAGCCATTTCGGCTGGGTTGTCGCGTATTTGATTCTTCGCG
TTCACAAACTGGTCCGTCAGCAAGATGCGCCGCTCGAAGCCCTTGATGAGCCGCTCCTTTGCATCCGACCGCGACTTCGAGAGCACCTTGACGGCTTCGT
GGAGCGCGCCGATGGCCTTGTCATAGTCGCGGTATTCTTCGATCTCAGCCTGTGCGCAGCTCCCGTAAAACGCCGCTAGCTGCTCGAACGCGCGAGCCTT
GGTGTAGAATCCGACGATGTGTTTGAGGATCTCGCCTTCCTTGCGCCAATCCAGGTTCTGAAGATAGTTGGCGGCCAAAATGAAGATCTCGTTGTTGCGG
GAGACGTTGGCGAAGAAGATGACCTTCTCCGTGTCGCCAGACTTTAGCAGACACTTCATGGCTTTGAGCTTGTCGCCGGCCTGCGTGTACTTCTTCGTCG
CCAGGTGGTACGAGCCCTGTTGTTTGCAGCATTTGGCAAGCTTCAGCAGCAGTGCTGTCCGCTTCTTCTGCTGGACGGGGTCCCCGCTCTCCTTGTCTTC
TTTCGGCGGCGTCATCTTCTCGGCCATTTCCTCTGTAACCTTGACGTCGTGCTGCATGCAGACATCGAGCGCCTCGTTGATGCGGTTCCCAATCAAGCAC
AAGTGAACAGCCTTGCCGAACTGGCCATTTTCGATGAAGAAGTCCGCGCATTTCTTGAGGATCGCTGGCGACGTGTTGCTCGACCCAAGTTCGTCCGTCA
AATGGTGTAACTCTTCAAAGAGCTGGGCTTTGAAACACAAGTCCAGCGCCTTGGCGATGTTTCCGCCCTTCTGGTACAACTGCACGGCCTTCTCCATCTC
GCGGCGCTCCTCAAAGTACACGGCGCAATCGATCATGTCGCTTGGCTTGCTCATGAGCGCATAGCTCATCAGGTCCGCGTCAAGTTGGTTTTCCTTGGCT
AGTCGGATCGCGTGGTTGTAGCATCCGCCACAAGCGAAGAAGTGGATGGCACTTGGCACATCGTTGAGCGCCTCGAACTGCCGAGCCAAATGGTAAGCAG
CCGCTCTGTTGCTGCTCGACTTGACGACCTTGGCTGCCTTTTGGAAATCTTTCTTGAAGCACAGCACGCGCACGATGGACAGGAAATCCTTGGCCCTTTC
GTAGTTCTCGATCGCTGCGTCGAAATGTCCCTGGCTCTCCTCGTACTGAGCCCACCACATGATGAGCTCGCGGTCGTTCGAGGTCGACACGTACTTCTGC
AGCAGCTCCAGCTTGCCGAGCTTGAAGAGCATCCTCGGGATCTCCTTCTGGTGCGTCCCCGCGTCTTCGTAAGCCTCCATCGCCGCTTTAATGTCGCCGG
TTTCTTCGTAGTACTGGCCCAAGGCATGATACGTCGTCTTGAGGTGAATGCGGTCGCGCTTGGCGGCCACGTCGATCGCTTTCTGCCAGTACCCGCTTGC
CTGGTACAGCTT