Description :
From Genome Similarity Track
Location :
Scaffold_1016:647- 2031
Sequence
1384 bases(100 bases per row)
CCCGTACTGATAGTACAGCCTTAGGCGACCGACGTAGAACGTAGGATGCGTGCACATCTTACGTGGCAGTTCAATCGTATGTGTTGCCTAGGTGGTGCAG
CACACGAAATGGACCGACGAACTTGGGTAGTAACTTGTTACTTCCCATGTTAGTTGCTATGTGTCGAGGTCGGTTTACCGTAGATAGTAGGACTAAGTCA
CCTTTATTGAATAAAAGAACATTTGCCCTTCCATTCTTGTCAGCTTTTCGTTTTTATCGATCTACCGCCTCTGCAATCGAGTCTTGTGCAAAACGGACAA
CCGTTTCGCGATCCAGTCTGAATTCATCTGCTGACTCATTGTCTAAATCTGCAGTGATATTGGATCGTACTGTAGCAAGATCACTTGTCGCCTCTATGAG
TGTGTCTTTGAACGCACTAGGCGTGATGCTGATTTGATCAGTATCATGGCCAGTAAGAGCATCTTCGCTCTTACTTTCGTCTTCTTCACCAAAGCCGATG
TGATCGACATCGGCATCGAACGTGGCGACCGCATTGTCAGCACGTGACGAGTGATAGACGGATTGACGGTCACTTGAATGAGCCCCCCCTAAACTAGAGT
CACACTCTAAAAAGGTGGGAAAACGCGGATAGCGTAGGCCATTCACGAAGAACGGCGTGTGTGTCGTCGACGCATGGACTGAATTGTTGATGGCGAACTC
CACCGTCGGCAGGAATTTGCTCAAATGTGTAAAGGAATGGACGTATCCTCGAAGGATCTCCTCGAGGACGCGATTAGCGCGTTCGATCGGACCATCTGTT
TCAGGATGGTCAGACGCGAACATCTTTAAGCGCGTTCCGACTATTTTGAACACGGAACGCCAGAACTCAGCTGTGAACCTCGGGTCCCGATCGGATACGA
GTTCACGAGGCAAATCATGTAGTTGAAAGACCGTGTCGATAAAGATACGGGCACAAGCCGATGAGTTGATTGATTTGGGTACAGCAACCAGATGTACCAC
CTTGCTGAACCTGTCAACGAACACAGGAATACCAGTATTTCGTGTGAGCGTCTGCGGGAAATCCAAAGACAAAGTCCATTGAGACGGATTCTCAGCAGTC
GGTCCTGACGGGCAGAGGATGCAACGGGGCTTGAAGGGAAGGACTAGATTCACCCGTTGACAGACCTCACAGGCCCGAACGTACTTGCGCACGAATTGAT
ACTGATGGGGACAGTAAAAGTCGCGGCTCACCGTGAGATATGTTTTCCCACGACCACGATGTCCACCAACTGGTGCGTCGTGGTACTCATACATGATACG
CAATGGCAGATCACCATGATCTGGTACGACGACACGAGGTGTGTCGCCGGCAACAGCCGAATATTGGAGTAAGCCGTTGCGAAC