Description :
From Genome Similarity Track
Location :
Scaffold_19:64682- 75110
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.41Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.10Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.11Serine/threonine-protein phosphatase

Sequence
10428 bases(100 bases per row)
AGCAGCGCGCCAAGGAGAACGACGCACGACAGCGAGCGCAGATCATCTACGAGACGTTCGAGGGCGTGAAGATCATCCCGCTGACCGGTGAACTCGAAGA
TCTCTACGTGAAGAAACGCTACACCCGCAAGTTTGACCACGTCTTCCTCTCGACGCAGCACAGCCACACGCTGCAGAAAGCCGATGATGAGAAGGCTGAC
GACTACCAGACCAAGCGTTTCACCAACCTCTTGGCTGATACTGCGGCTGTGAGCATCGAGTCGTCCGTGTACGTGCCTAGTTGAGCTTACCACCCTTGAG
CGATAGAGTGCCAAGGTACTAAAAGTCTCACTATGAAAATTGGTTGGGCGATGCGTTTTTCCTATACAGGTTCTTGCTTCCGCTGAAAGAGGACCAGCGC
GTGCTCTACATCTCCAAGCTGCTCGAGATGACGCAAGCCCACGCGCTCAAACCCTCCTTCAAGTTTGCAAACGGCAGCGGACCGTCACAAGAGGACCTGA
GCAAAATCGACACGGCGGTGCTTCGATTCGATTACATTAGATGAGCCTTCATTGATAACCTGTGGGTTGGTTGGGGCGTATCGTCACGAAAGAAACTAGC
TTCAGTACTAAAATGAACAAACACATTTTATCGCCAAGTTGCTGTGCTGAGGCAGTTGATACAACGACACTGAGTCCTTCCTTTTCAACCAACTGTATAA
TCTAACTGATTGAGCAGACAACTCTTTTCTATCCATTTGGCCATTGAAGCCTGCTAGTGCCAAAGGAGCAGCGTGTCAACAAGCAACATGGCAACAAATC
GAGCCCTGGTCCAGATTTACGATATCGCAAATGCTGAATCCGTCATGCGAATGTCCGAAGCACTCGCAGATGTAGATATACTGCTTTCCAACGCGCCACC
ACCAGCACTGTGTGCTGGTTCCCGGCTTTGGTTTTGGCTGGATCCATCAAGAAAATATTGTGGAAATCGAAAAATGGGTTCTACCCCATAAAGTCTCGGT
GCTGAAGAGCCCTGTGATCTCGCTGGTGTTGAATGGGGAGTGTCTGTCCATGACGCGAGTTGAGAGCTTACCACGCATCCTGGACGAAGCTCTCAAGTCA
CTGGAGCTCAAAACCAGACGCATGCACAGCGAAGCCCGCCAGGACATTACTCGATTCTGCCCAAACTTGATTCTGGGGATTAAATCCAAGATGCTCAAGC
TCGAAGGTAGCGCTCTCCAGACCTTCTTTTCAGAATCCAACGTCGCCCGTAACCTCCGGGCGCTGACATTCAACTGGGGCATTTACAACCCACGTGTGCT
GCTGGAGATCATGGCGAACCCAGCGCAGTATCCAGTTGTGAACGCGCTTGAAGAACTTCATCTCTGCTACCTCCACAGCAGTAGCGATGACTTTGTCGAT
TGCCTTGCAGGTTTCTGTCGGATGCTCAAGGGGAACCAGGTGCTAGAGAAATTGTATCTGAGCGAGTAGATTCGGATCCGCAAGCCTTGCGAAATTTGCT
GTTCGTTCGACCTGCTCCGCTGGAATCGCTGACTGTGCAGTGGCATGTGCGTAACCCACCAGTGCTGACGAAGATCTTGTCGAGTCCGGAGAGGTACCCA
GCAGTGACCTCGCTGAGGGAGCTGCACATTCACGAAACACGACAGCATCGCCGCTATGGGCGCGAGCGATTCATCGACCTGCTCCGCAAGAATCGCGTGC
TCGAGTGCGTTTCATCCACGGAACCGCTCGAAATCTCAAAGAGCTACAATGTGTTGTGGAGCGCTCCAATGTGAAAACCGTCTCGAATGCGAAGGTGTTG
CAAAGCCGCTGGGGGTTCCTGAGCGCTATCAAGCACCTTATGAGCAAGAGTCAGAAGGCAGGTACTGAGCAGGGAGCTGCTCTCGATGATCTTTGAGTTT
GCCACCGTTCGCCGCGAGGCACCCGCCAGAGACCATAGCTTTGATGGTTAGGAACACTCGGAAACTCGACTCGCTGTCAACGGTGGGGGGTGATGCGACT
CTGTGGCGTCTGGTTGAGCTGGGATTGGATTTGTTTCACTCGTATGATCCCCAACAGTGTTGTGTTTCTAACCTCATTATAACGCCATGTTGGAATAGCG
ACACTTACTTTCTCAGATTGAATAGTTCCATTTTCAACCTGTTTGGCTGCCAGTGGAGCTAAGGAGGGCAAGCAGCCATCAAATGTGCGCAGAGTTCAAT
ATTCTCTGGGGCGAGCACGATGTGGAGCGTCAATGCGCCTCTGCTCCAGCTAGGCGGCGCGATGACGCCGTCGCACGCGGTCATCCAGACCCCGGAGCAG
CTCCAGGAGCTCACAGCGAGCTTTGCGCATGCAACCGCCACAGAAAGTGAGCAGCATGACGACAACAACCGCCGCCACCGCGTCCGAATGGATGCTACCG
TGGATAAAACCATAAACCGAGCGACGCTGGGACAGTTCTTTGCAGAAGCACTTAGTGCGAATGGCTCTCAGAGCGGTGTACTACCACTGACACAGCCAGT
GGGCAACTTCTCAATGAGAGCCATTCGAGTCCTCGCTGTCCACAAAGACAGCATGACCCCGCAGCGATTCGCGTGTTTACTCTCGGCGCTTCCGCATACG
CGCTCTCTGCACACGCTGCGCTTAGAAGAAGCCAATCGAAGCTTCCCGTGGAAGTTAAAGAAGCTGGAGCTCAGCTGGCTTGCGTACGCGCTTTTCCATC
CAGAGACCAGAGCTTCAAGTTGGCGGAAGCTGGTGGTGGGCAACTGCAAGCTTGTCGGCGACGTCACGGTCGTGTTGCAGCAGATGGGTGACGAGAAGTT
ACACAGTGAGTTGCTCTCTGCGGCGAACTTGGCGACTTTGATGGGGGTCGAGCGGCAAGAGAAGAAGCGCAAGAGATGTGACGACGCTACGCCGACGCCG
CCATCTCATCAAGCCCCACATCAGCTTCGACTCGCCTGTATCAAGAAAGACACTGTCATCCGAGTGGGTTCTGGCGGCAACGCAGTGCCTCTCGTGACCA
TCCAGAACATGGTGGAGCTTGAGATGTGTGCCTTTCGATCCGAGGTGTGGCACTGCGTGCTCGTGCCTGGCTTTGGCTTCGGCTGGGTCCACCAAGGCGA
CGTGCTTGAAGAGAAACCTTGGGAACTCGAACTACCAAACGCTAGAGGTTGCTCTCCACTGACCCACTTAGAGCTTGGATACCCGATCACAATGGCGAAG
GTGCTGCTCATCCTGGCGGCGACTGGGGGATCGCTAGAGTCGCTCGTACTGGAGTCTTTTGGACTGCCGAGCAGCGTCTTGGACGACGTCTCGCGCTTGT
GCCCGGGTCTCAAGTCGCTCGGGATCAAAAGCTCCAGGGTCTCGCTCAGCCGGACCTCGCTGCAGCGCTACTTCTCCCAGCCCACGACACGCCATCTCCG
GTCCTTGGCGCTGAGCTGGAGCGTCTGCAACCACACGGCGTTGCTGGAGATCCTCTCGAATAGCGAGGCGTACACAGCAATACCATCGCTCAAGGAGCTA
CGGCTCGACAAAGCGCACTACGTTGGTCAGCTTGCCGCGATGCTTGATGCAAATCAAACGCTCGAGAGACTAACTATTGACCAGTGGAGCGGCTCGGACG
CGTCGCAACTGCTGAAGCACCATGGCGAAGTCCTGCCGAGCGCGAGAGCCTCGATCACGTTTCTTAGTGTCATCGCCCAGCTCTCGAAACAGAACGGAGG
ACGAGTCTTCGAGCGCATCGGCAGGGACTTGATCACCCTGATCGTTAAGTTCGCAGCGGTGCAGCGTGAAGTCAGCATCTTGAATGCGCCTCGGTTCAGG
GGTTGATCCTATGAAGTAACCTTATATTTGTCTTGCTATTCGCACTACAGTAAGCAACGTAATCTTGCCCTGAGGCTGGAGATCTTTAAACTGGCGCAGA
TGGGCAGTCAGCGGCCCGAAATGTGAGGTTGAAAGAAATCTTGATTTGTTGTTAGTGACCTCTCCCATACGCGCGATCCGTTCACACTGCTCAGCTTTCA
AGCGATAGCGGATCGGAAGTATGGAATCTGCCAGCGCTCGAGCTCAGCTGGATCACGTACGCCATTTCCCACCCTCAAAGCAAAACTTCGAGCTGGAGAA
ATCTCATGTTTCATATGCTGCGAGCTAGTTCGAGGTGCTGCAGGTGGGCTAGCAGCGATGGAGGCAGCTTCTCGCCAAGCGCTCGCTCCAAGCGAAGGTG
GTTCGACGACGAATGTGCTGGAGAATTTAGACTGAGGATCCATTCCTTTCTTTCTGTAATCACATCCGCTTCATTTTTGGATGGCAACTTGAGGAGTACG
TTGATCGGATTGGCGCCATGCTTGAAAGCAACCAAGTTCTCGAGCAAGTGTACCTGAGCAGCTCGACGAGTTATGAAGAAGCTCGCGCGCTGGAAGACCT
CTGGAATAAGAGGTTGGTAGCTGGAGGATGTCACGCAACTGAGATCTTCTCGTCTTGATGTGTTTCATCATCAGCGACTAGTGCCGACGCTGGAAGAAAG
AAGCACGTCTTTGCCTTTTGGTCTTCTGGACTGCTCAGACTGGTGTGTCCTTCGCCGAACACGCTTTTGAGTAGCACGTCAAAATCTCGGGCGGTCTGGT
GTCCTTCAACCCGCGTTTTCTTGTGGACAACATGCCACTGAGATGCAACACAGCACACTGGATAGGTCAGTGAAGATTGATAAAATGATCTCCCGATGGC
GCCAACGAGAACGTACACATGCAATCTAGACATTGCTGGAACGTCTACAATCATAAGATAGCAGATAAGAGATCACTGCGTAGCTTGGCAACCTGTCACG
ATCAAGAGTAAGCCAACTGCTTGCTGATAAAGAGATACCATGCAACACTCTTACATGCGACCGCATGCGTCTTCTGATATGAAAGCAGAATTTGAGGATG
GGAAGAGATGAGGGCGAACGAACGTTTTTAACAACTCGTGTGCACACGTGCATTTTTTTTCTAACAGCTGGACCTGTTGACCGATGAGACTGGATGCATT
CGACAACTGTCATGATCCTCATTCTGTGCGAGAACATTCACCTTCTCAACCAAGAGATGTTGCGTCCAAATGTGTGTGAGAATCTCATGACAGTACTGGT
AAATGAAGGCTATTTATTGGCCAGAGACAGACATTTGCTGATGGGGGAGCGTGGTGCAGCAAAGGGTTACGTTTCCGTACATTCATCTCTATACACATGG
CATGTACACCCAAGTGTGTTCCGGCACCAGAATTCAAACACTACACAAACCTATTATCTACGCGTACTACTTCCTATACGCATGCCGTATAAATTGCCCT
CCCACCCATGACAATTTATACTACACCCGCGTAACCCTCGAGGGACCAGTGACAATTTATACAGTATGCGCGTAACCCAACGTGCGTTGTGGGTTACGCT
TAAGCGAAAAGAGAACCAGCGACAAACAACAACAGCAGCTCACATCACATTTGCACGAAAAGCCAAAGAAGCCGTCAGACGATCGTCGCGCGTGGCTCTC
TGCACGACGCGCTTGATTGGTCAGTCGCTCTTCTCTCCCCCTGACTGCATGAGTCTCGAGTGCTGCGGTCTGGTGGCCCCAATGGACACGGAGGGTCTCT
CGACGCGCGGCTGGGGCGTGGGCCACCTGATGATGGTCGCGCCGGACGACGAGCTGCCGGTGAACAACTACAACGAGGACCATAAGCTTATGGAAGGCGC
GCTCATCAAACTCGGCGACTACGCGCACTTCCGCTACTTTTTACTCTATCGCAACGGCCGCTTCTGCTATTACGAGTTACCGATCCCCGCGGGCGGCGCC
GGCGGTGGCAACCGACGTGTGCACCTGACGCTCACGTCCGAGCATCTGCGTGGAGTGATGATGCTGAACGCGTCGATCCACGCCAAGGAGCTCGCGAAGA
ACGAGGACGAGTACGACGCGGATCTGATCAAGCGGGGACTCATGTTCAACCGCAGGAAGCTCGAGATGAACCTCACGGGGTACTCGCCCACGGGCCAGCT
CATGTCGTGGAAGCTGCGCGCATCGAATGACGCAACGTACACAAAGTGGGAGCGCGCGTTCCGACTCGCCTTGCGTCCCATTTGGGTGCAAAACACGCCT
GCGTGTCTTGTGTGTCAGAAGGCGTTCTCGTTCCTCTTTCGCGCGCATCACTGCCGGTACGTTCTGCGTATAGTTGCTTGTTTTGTCGCTGTTGTTGAGC
ATCTGTCCATGATATCCTAACCATTGCATTATGTGTTCTCGTATTGCGCAAACTAGGAAATGCGGCACGTGCATGTGCGACGAATGCTCAGTGCTTGTGC
CGCGATTGCCCATGCAGGGCTACTATGACGAAGTGCGCATCTGCCGGGACTGCTCGCCGATTCGCATCCAGCGGTCGTCGCTCAAGATGGACACGCGCGT
GCTTGTGTACGGCTCATACCCGGGAAGAGTGATTCAGGTGGACGCAGCAGACGACTCGGAGGAAGGCCACGCGTACGTGAACGTCGAGCTTGAGAAAAGC
AGCGATGTGCGCAGGTTCCCGATTGAATACGTGGAGCTGTACTCGGAAGCCGTTCTGTCAGCGAACCGCATTAAGAACGCGATTCGAATGCACCTCTCGC
AGTCACTTTTCCGCACGCAGCTGAACTTCAGCACGTGGAACCTGCTCGAAGCCGTGCAAGAGCAGAAAACCGTGCAAATGGTGAAGATTCTGAACAAATC
GACGAGCATCACGGAGCTTCGCTCCATGGTACCCAACCTGGGCTCGCTCGAGACGTTCCAGTTCCCACTGGACGACGAAACGGAGAGCGACAAAGTGCGC
GCCTCACTTGCGCATTACCGTGGTGTTCACGTGATGTTCCCGCTCCGTCTCGACACGGTGACGAAGTTGATTGACCAGTTTCGCAATGGCATCCTGCTGC
ATCGCGTGTACGTGCACCACATCTTGGAAGAGTCTGAAAAGATGTTTCGCATCGTGCACTCGTCGCCGATGAACGCGATCGAGATCCCTGCGGGCGTGAC
GCTCATTGTCGTCGGTGATTTGCACGGTCAGTTGGAAGATCTGCTGACGATTCTGGACAAGAATGGCGTGCCGAGCGCAAAGATGTGGTACCTCTTCAAT
GGCGACTTTGTCGACCGCGGCTCGCACGGCGTTGAAGTGATGCTGCTGCTCCTGACATTCAAGCTGCTATACCCCAATTACGTGTTCCTGAACCGCGGCA
ACCACGAAGAGCGCATGATCAACGAAGTGTTTGGCTTTGAAGACGAAGTGTACGTCAAGTACAACACTGACAATGACGAGACGCTAGGTTGGGAAGGGCT
GAGCTCGTCACCAAACTACTCGCCCATGACGCTCTTTCAGATGTTTGAGGACATCTTCGCGCTGTTCCCGATCTTCTCGCTCGTGAATGAGAGCGTGTTT
GTCGTGCATGGAGGGCTGAGCAACCACGACAACGTGCGCATCGAAGAGCTGCTGAAGATCAAGCACCAGCGCGAGATCCCGACCCAGAGCACGAGTCGCG
AGGATGAGCTGTTTACGCATTTGTTGTGGAGCGATCCGCGTGATCGAGACGGATGGAAACCCTCGGGACGAGGCGCTGGTGTCGAGTTTGGTCCTGACAT
CACACGCCGATTCTGCCAGCTAAACCACCTGTGTCTCGTGATCCGATCCCACGAATGCCGTGAAGAAGGGTACGATATCGCGCACGACGGGTTGCTTCTC
ACTGTGTTTTCAGCGTCGAGTTATTGCGGGTCGCAGACAAACAAGGGTGCGTTTGTGCAGCTTCAGCTGGTCGAGCACGGAGATGTAAAACCGCACGTAG
TTCAGTACTATGCACAGCCATTGCAGAAGTTGCGGGATGCAGGAAAGAACGAGTGGCGGCAGAAGGCTGTGCGGTTGGAGAGACGCACACTCATGTCACT
CGTCGAGCTCATTTGCGAGAAGAAGAGCTCTTTGCTGGCGGCGTTTACGCAGATCGACACAAAATGCACGGGACGAGTGACACGACTGCAGTGGAAAGCG
GTGCTCCAAGCCGCTTTGGGCATCGAAGTGAAATTTCTGTCGTATTTCCACCAGCTTGCGACTGAAGAGGACGACTCGCTCGGTGGCATCGACTATAAGA
ATTTCCTGAACCGGTACACTGTGGAGCTCGGCGGCGGCAACGCAGACTGGAAGAAGCAGGTCGCACAAGAGATCTGGGCTGGTTTCTCTCGCGCAGTTTC
ACAGAACGCGCAGCCGAATAGCAGCGACGGCAGCGCCAGTAATGGCGAATTCAAGTTGAAGACCTCTCAAGACAAGCTGCAAGCAGCGTTTGATCTTTTC
CAGCACACACCACTCGCGAACAATAGCAACAACTATAGGGCAGGCAACGGCGCAGTCCCCGAGAGCAATCATGCTGGCGGCATCAGTGTCGCATTGCGCC
GCAGCAACGAAAGCTTTTTCCACAACGGGCTGGTCACGTACGATGTCTTCCGAACGACGTTGCAGCGAAGTCTGGTGCTCAATGAGACTTTATCGGAACA
GCAGATCTTTGAGCTGATGCAGCACATGGACCAGAACCATGACGGGTTTGTCGACTTTACCGAGTTTTGCGCGTTCTTCGCCGAAGCGAGTCAGTCGGAT
TTCCTCCAAGACTTGTTTGAGGGCGAGGACGTGAAGGCGATCGAGTTGCTGCACCAGTTTGGCTCGCATCTGCAAGATTCGAAGCAGTTCAAGTCGCTCA
AGGACGCGTTCTTGACGTTTGACAGCAAGGGCACGTTCCGCTTGGAAGTCGGGGACATTTTCGAGGCATCTAAGCAAATGAAACTCTCCCCTGCGCTTGA
TGAGCACGACGCGAAGCTGCTCTACGACTCGATTCTGCGTAGCTACTACGGTGTGACGATGCGAAAGGAGAAAGAGCAACGCGGTCTCGACTGGGAAGTC
TTTGAGGACGTGTTCTCGCCCGATAGTGCGCTGCAGCGCCGATTGCGACTCGAGAGCTGGAACGCGTCGACCACCAACTTATCGGCTTTGATCGACAATA
CAAACTTGACGGCAGACGACGAGAACGGTGCAGAGGGCAGTCCACTTGGAGGTGCCGGCACGACGGCGAGACGGAACACGTGGGCTGAGAATCTGGTCGA
CAGCGCCAAGCACTCGCTGCACGAGCAACGACTGTACCTCAAGTTGCTCTTCCGCATGCTTGACCGCAAGCGCATGGGGTACGTCGCAAAGCACAAGTTC
ATCGCCGTGATGAAGGTGATCAACGACCAGCACGGCTCGCTACTGGACCAGGCGGAGCTCGAGCAGCTCGCAGAATCGTTCGCTCACCGTCCACCCGTGA
AGAAGACAGCGAACAAGGTGAAGAACAGCAATGGGAATGGCAACGACGCGGAAGAGCCAGAAGAACAAGCAGTAGAAGAGCAGCAGTTTGTGGCGTATCC
GCTCTTCCTGCGCAGTCTGCGCGTGATCGACTCCAAGTGTAAATGCTGTTGATTTTAAGTTATAGAGTATCCCTTTTACCCTGTCCTTCTCCATTCTTGG
CTTGGAAATCGTCGTAGTTAGAAGAAGATTTGCGAAGGGGCACCGAGCATTTGAGGGTCCGTCCAGTCTAGTAGGCATACGACCGCGGGCATTGAACATT
TTAGAGGCAAAGAGAGTGTCACGCAAACGATGAGTGAGCCAGCAGCAGCACCAGCGAACGTCGATGACAAGCAACAGCAGTCAGCAAGCGAAGATGATGT
GGAGCAGCAGCTCAGCGCCACGGCCACGAAGAGCAAGCTCGACAAGCTCATGACCGACTTTGCAACCTTTGACGATGTCATGCGCATCGGCACGCGGGTA
CGTATGTACACATGCATTGCTCTCTTAGAGCTGCCATGATCGTTGGCCGTTTTGAGCTGATCTTTAGATGCATTGGCTTGTTTCATATAGCAACGCAAAG
AGCGCGATGAGTTCCGCTTGGCGGAGATGAAGCAGGAAATGAGTTGGCTCGAGAAGAAGCTCGAGGCGGAGATCAAGAAGCGCGTCGAGATGAACAAGTC
GCTACAGAACTACTGCGACGAGCAGGTGGCGCAGATGACCGTGAGCTTTGAGCAATTGTTGAGTGACCGTGCGCAGCAAGTGCAAACCCGACTCGATGGG
TTGGCAAACGAGATCAGCGACATGCAGAACCTCGTCGCGCAGGAGAAAGTCGAGATCCCGCGCATGATCGAGAACAAGACGAACGAGCTCACGCAGAAGC
TCATCGTGTTTATGGACGCGTTCGAAGAGGAGCGCAAGCGCCGCGTGAGCCAGGAAGAGATGATCCTCAAGCGCCTGAGCGATCACGAGCACGTGACCGC
CGAGACCTTTGAGCGCGAGCGGGTGCGTGAATGCGACGACTGCACAGTATGCTATACCTGTCCAGCGATCCTGACGTGCTGTTTGTTGGTGCTCTGTAGC
GAGACCGGGAGCTCAAGTACTTGGAGCT