Description :
From Genome Similarity Track
Location :
Scaffold_259:6468- 11481
Transcript NameFunction/comments
Phyta_totarag6311hypothetical protein PHYSODRAFT_339333
Phyta_totarag6312conserved hypothetical protein
Phyta_totarag6313hypothetical protein

Sequence
5013 bases(100 bases per row)
TTCAGGCGTACGCTCGAGCCTCAGGGACGTTGGAAACACAGTTGATCCATGCAAATTCGCGGTATCCGGAGCTGCTTGACAGCTCATCGGCTTTCGCGAA
CGCTGTCCGTGTCGGAATCATCATGAGTCGGCAGCTACACTTCGACAGCGGCGGGATCTTCGACCTGCTCGAGAGCAAGGTGGACGCCCGATTTTTCGAG
CTCGACACGATCGTCAGTGAAGCCCATCAGCCAGTGCAGGAAGGTGCCATGGAGCGCATTCAAGTTTGCCGCGAAGATGGCAAGGAATCTGCTGCCGCAG
TGGAGTTCAAGCACTCTCGTCTTTTGCCGTTTGGAGAAGATGCCACAGCGAAAACCATTTGGGAGATCATTGAACTAGGTCGCCTGTTCACCGATAAACA
ATTTCGCGTTGCAAGGCACTCCGCCGACGTGGTTGAGATGGCGTCTCGGTTCACGGTACCCTGGACAGAAGCAATAGCAGCTCCGTTAGCGTTGATGTGC
GTGCCGTGGTCAAGCGTATATCCACCTCAGTTGGCATGGTAATCTTGGTCTAGTCGCTTTCGGAGTGGTCGATGAACCACCCGACAACAGGACCTTGGAG
ACAAACAACCGAGGAGACAGGCTGGGTCGTCATGACCGAGCTCCCACGTCAGCAGGATGGCACGTCACAAAGTGCATGTCAACTGCGATCAGCGATGAAG
CTTCGACCGGATGATACGACGGGtggttgcagcagcgctcgctcgACGTTCACTGGCAGCATGGGCGACATCGTCATCCCGTCGTTCCGTGAAATCCTCA
GCTCGCACCACCAATCCGTAGAGAATTTCTTGCTGGACTCGTCGCGGATGattgcagcttgaacagTAGATGAAGTTCACAGCAAAAGTCGTAGCTAGAA
CGAACTCTCACAAATACAGCGTCTTAGCTAAATACTCTTAAGCTGCAGTAATAAAATATTATCCCAGATCGACAGATATCGTAACCCACATGATGTCCAA
TGTCAATGCCACCCAGCAGATTGTTTCCAACCGACCGAATTAACAGGTTGATCATGAAGTCTTGGCCTCATCGAaagcaagagctgcagcgaatCGGAGG
CGTTTGAAACACACATTATATACAGCGTGCCCGCAACGTGTTCCAGCTAAGCTCGATTAATATGACTAGGTGTGGGAATCGGTGACTCCATCGCGAAGTA
GTCAAGATGAAAACACGCAGCTGAAAAACgagctgcagatggagctggtTGCGGCTGGAGTGCAACGTCAAAGTCGCCTGGTGATTGATTACCGTTCACT
GACGCTGTTCGAGCACGACAATTCAAGACTTGCCGACCTgttcgacaacaacaagatcTTCAGCTCGCTTGAGAGTAGAGTGAAAGAGGCGATCCCACCA
GCTTGGCATCTTCATCCGTGAAGCCTATGAACCGATTGAGGGAGACGTCTGCAACGAGGCAGCCACGATCAACTTCTAAGGTCGGCAAATACGCAATGAT
CAGCTCTAGGTGGCAGATATAGCACCAAGTTGTGCGTGGTGCACGAACCGCAGCCTCCAAACTCGCAGCTCTGCGGGCATTTCAGCCGGCCCGACCAAtg
gtagtacatgtacgaacaCGAACGCCGAACCGGGCAAATTGCCTGGCGTGTCGTGATGGAACGGAAGACATCACGGCTGCTTCGAGTTTACTCCAGTTTC
ACCACCTGGTTGGTCTCGGGAAGGTTGCCACGAAGCGATCGCGGAAGGCtgaagccgccgccaccatcTGAAGCTGACATCTGAGAAATTGAAGCCCCGA
CATCGTCCTCGGGCTGTTGATCACGCCCGACAAGTCAAACAAACGCCGTGGAGCGGATGAGAACGCAGTGTGCCAGGAAGTTTACGAGCCCAGTTGCTCT
CTTTAACATCCGTCGTCGACGGGTTGTGGAGATCATGCGAGGGCGCAGACAGCCGGAGCAGGACTGCGTTGTAGTCCGCGTGTGTAACCTGAACCTGCAG
CCGGTTGTCTCGCCCGGCTCGCGGCCCCCGATCACAAGAGACCAAACCCTGATTGTGCTCACGCTGTTGACGGGAACGTGCCGGGCGCCGTAATCAGAGC
TGATGGTcctgctctgctgcagtgtgtacatgtaccgggTACCGTTTGCTGGACCAGCACACATCCACCTCCTGATGATACGTTCGGTGAGATTCGGCGG
TGGTTGAACGCGGCACAGGCACGCACAGGCCAACTCCACGAGGATAAGACGGCTGAAGATAAGCTGCCaaaatgggggggggggcaaaaTGTACATGAAT
TCGATGTCCATCAAAATTAGCTTACAAAATAAGCACATGTTAGTTGCCGACTGTCATACGTTGCAAGGCTGGATTTGGAAATCTTGTTTGGAGTGTCGAA
AATCAAGAAACAAGGTATCAGATTCCGTTGGCCGTAATCGAAAACTTGATGGGCTAGCGCACCATCCTCGCCCTCATAAAACGCATGCATCTGATACTAC
TggtgattggtcgaaaatCTACTCAACCAATCACAACAGCGCTAAATCAGCTACTGAAATGTCGTGATTCGTTGAAGCGACGCGACTATGCACGAGTTGA
TTCGACACCTTTCAAGCGTAAACGGTTAAAGCCGGGCGAAGCCGCAATCCATTTCCTTCACGCAACATTACGCAACATAAGCTGTCTTTGcttttgactt
gattttgtTAACTTCTCTGCAGATCGCCTTCTTTGCCAAGTTGCTCGTTACTCACAAAGGTGATTCCAAGAAGTTGCGCACCTCttctttgctgctgttg
tgaGATTTTTACTGCTTGGAGAGCCTGCCGCAACTTTACAGCTCCTCCTCAACAGTGTAACGCTTTTCTCCTCCTCAAACTAGCTGCTCAGTTCCGGTTT
TGCGAAGAAGTTACGAGGACGACGGAATGCACTGCACGTCCCGTAATGGCGACACGGCCGTATTCACGACAGAGATCCCGCCTCTAGGATCCAAGCGCGA
CGACTTCCTGGCCGCCATTCTAGCGCAGAACATGAAGAAGTACGCAGTGGCTGCAGGCAGCAAGCGGAGCTGCCCGTTCGCCGCCCCCGCCAAGAGACAA
CGCGCGCGACGCccggacgacgacatccaggcgctgcagcaggacgtggaggatCTGGAGGCGAGACTCGCGGCAGCCAGGAGGCGGAGACAGCCTCAAg
acaagaagcaggtggacgCCAACTGCCTGCGCAGCATGCTGCAGGCCTGTCGgaagcaggcgcagcaggaCGCGAGCATGGGCTTCGCGTTAGGCGCGGG
CATGCCGAGCTGCGGCCAGCTCGAGTACGAGCCTAGCGTTGACGCGCCCGTGTTCAGgcagatggagaagagcgtTTCTGACCAGTACGATCAGCTGGCG
CAGGTTTTCAGGGACGCGGGGCTCCACGAGAGCAAGCTGGACTTGGACGACGCGCGCGTCGTCACAGGAGGCAAACAGGGCACGTTCGTGCGCTTCACGA
CGTCCAAAGTCGCGCCCTTCGCGCTAGATGTTGTCAGTGGAGCCATGTGGAACGGAGCTAAGAAGAACTCGGTGCTGAACATGGGAGCACTCGACCCGGC
CAttgaagacggagatggcACCGTCATGTACCTCAAGAGTGAGTGCATGCTGCAGGACGATACGGCCGGCGCGGCGGCCGTccccgtgctgctgcgcggc
gTGTGTCGTCGCTTTGTAGAGCCACATCGCATCGTGCTGGTCTGGGAAGGCACGGGGGACTGGCCCAAGGCCTACCTCCGAAGCCACCCGAGCAGCGTCC
CGATCCGGGAGCGTGGCTACTGTGTCGTCCAGCCCTTCCAGAGCGGTAACAGCAAGGGTCGAAGCGCTGCCCCACTGAGTTTATTCCAGACCTGTGTCTG
CATGACGCCCGGTCTGTCGGCCGACATCGACATGGACGAACCGGAGTGCTTGGAAATGCTCTCCAACGTCGTGATCCCGTCCTACCGCAAGATTCTCGAC
GCACGTGAGCAGATGCTCGAGAACGCCATCCTCGACGAGATGATTCACTCCAAGATGCGTGGCTCCACCTCGAGGATATAGTAACGAACAAAGAAGTTCG
ATCAAGATTTTAACGAAAAATGAACATGTGCCATATATTTTTTCCCGATATCTTATCTATTAACTGTGCAACAAGTCGAGAGGAGTCTTCTCTCCATTCA
CAGACGTTGAAATATTGGAAAACATCAAATAAACTTGGCATTTTAGATAGCGGATATCGTGGAAGATCCGAGTGCGAATGCGGCGTCCAGGAGGCGATTA
TCCACACATTGCTGCCGGTTGCGGATCAGCGTGCGGAAGGACGggatgacgacgtcgctcACAGCTGGACTGCCCAATAGCTTCCGGTTGGTGTCGCGGT
CAAGCCCAGACGGTTGGCAAGTCATATACATTAAGAACCTTGACACGGACGCAGGTGACAGTGATGTGTCCTGTGCAGCCGATCTGTTTGCGTTAGTTGG
ATACGAGTGCACCAGGCCCCATCCGCTTTCCCTCGTCACGCGGGACCACACTCCAGAGGTGGCCAAATGGGCAGGCCACTCAGTGGTAGAGTCGGCTAGG
ACGACAAAACCTTCCTGCAGTCTGAATCGCTTAGCAACGCACCGAACTCGGATCTCCACGGTCTCACCCTTCTCGAGTTGAACAGGAAAGCACCAGTCGG
ATGAAGCCACGTCCCTCGATCTCCTGACTACACGAGCTCCTTGTTTTTTCCAGCCCAACTCGGCCACTCGCCAGCACACATTCGAGACCGTGTCCACATC
AAACGGCAGCACCCGCGCCGTCTTGAACTCCACGGCAGCGTGGCTTTCATCCTTGCGACAAATGGAGACCTGCTCGGTGtttgcagcaagcacagGTTGC
GACACCGCACTAGCAATATCTTGAATCTCGTGGACGCGAGCGTTTACGCTCGCTTCGAGCATGTCAAAGATGAGCGCGTTATCCGCCGCCTGGTACTGCT
GGTCCATCATCAT