Description :
From Genome Similarity Track
Location :
Scaffold_583:6468- 8099
Sequence
1631 bases(100 bases per row)
GTCATTCTATTCAGACCTTTGATGATTTGCGATCGCACAATTCGGATGAGCTGTATCCGAATACTACTACCGGTAGATAGAGACAACCAAGTTGAGTTAC
AGAAATTGGACTGCAGAGCTTCCAGCTGGATAAGTATTTTGCTTTATTTATAGCCGGCAAGAATTGTGACGCCCCGCATTAAAGGAGGCAGTAGAAGTAG
ATGTTGTGATGATAAGATAGGCAGTTTGACCTGAAAGAGGATAGTTTTGCCTAAAATCGGCTGAAGATAACTCTCAATTAGAACGAATATTAAAAGAGCC
TTTACGACTTGAAATAAAATCGGTATAGTTAAAGTATCGTTTTTGACGACAAGAGCAAACTACATGTAAAATTGTTTAACAGGAGCGGGCAAATATGATA
GCCTTCGCACCCTTCTCGTAGATTCAGCATGCATTGATTTAACGTGTCCTGCTCCTCCCACGCGGTGTATTCACATCGTTATGTTGTCTCGCTAAATCAA
TGTTAAAATGTCAGGCGGTTGTAGAGGAACGATCGGGCAACGCACTTAGACTAGTGATCCACACTGAAATAATACAAGAGCAACCCTATATTTGTGCCCG
TTTGAATTCGAATTGTTAAATCAAGTTGTGACGTAGTACTGATAAGCGCATTGGAACAAATCGAAGATTAGAAGCATAGAAATATAGTAAAGGTTGCTAA
AGGAGCTGCAGATCCTCGCAATTTTGATTTTATGAGCTTGCAAGCCTACAACCATGTCTGAGCCGTAGTATTCAGTTGTGAGCTAGACCTTGTGACCCGA
ACGCTTCATAATCGATTCAAGTGCACAAGATTAACGCACCTGATATGCGAGCTATTTCATTCTGATCGTGTATGTTGAGCAAACAGAACCTTAATTTTGC
GTCGACACTATTGCAGAAATGAGAAGCACGATATGACACATGCTATCCTAACATAGCCGACGTTTTCAATCAAATTTGCCGAGACGTAAGGAGTGGGTTG
CCATACGTTGTATGCGATCACGTTGATCTCCTTGAATTCACTGTAAACAGTCATTTGTGAATCTACCGTCAGCTACTCACATGCATCAAACAATCGTCAT
AGCGCTCAGCCTCATTTGCTCAAAAGCGATTACCACACAACTGCCAAATGTCAGGACCAACGGTAAGACAAATGATTATAGTAAAATCGAGAAAGGAACG
CATCAAACCCTTGCGTAGCTGCCTACTCGCGCTTTCATATCGCCGGATGACAAGAACGTCAACAATGCTGCTGCACTCAAAAACAGTGAATCAATGCATG
AATTCGATGGCGTGTCGCCTTCATTGCTTTCAGACTGCGTGGAGAAGGATATCAATATTCTAGCGCAATATACGGAGCAAGAATGCGCTGGTGGAGAAAA
TCAAGTATGCGAGAACATGCGTGATAAACTTAATGGAGGTTTGGAGGGTATTGCTGACGATTCGCGTTGTGAGCACAGGCTCCAAACCGCTTCCCTGGCA
GGTACGGACTCAAAAAGGGGACAACAAAACATGCGGACACATGGGGAAATCAAAAAAATGATTATCGGGGGATTACAATCACCTCCTTGTCGAAAAGTCA
ATAATATCTTCAGATCGACTTTGCAATCTTT