Description :
From Genome Similarity Track
Location :
Scaffold_329:6467- 7518
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.14MGC89050 protein isoform 1

Sequence
1051 bases(100 bases per row)
AACAAGTCATGATCCAGCACGAGAAGCACCTCGTGGTCATGATGCGCTGCATCACAGTGCTCCGGAACGTCGCGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGCGTGCTTACAGGCATGCGGCTGCACTTGGGCGACCCATCGTTGCAA
CAACACGCNNNNNNNNNNGCCACACTCGCCACGATCGCGCTTCGTGCTCCAGAGAACAGTCTGCGCATCGTCGATCTCGGCGGCGCGCGTCAAATCGCGT
TCGCCATGCGAACTCACCGCGAGAACACAGCCTTACTGCGGCAAGCGAGTCTCGCGATCCGCAACATGGTCGCGCGCTGCGTGGAACTGCGGCCGCGCAT
CCTCGACGAAGACATTGAGCCGCTGCTGCGCGATGCGCAACGATACCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGCGACATTCAGCTCTCGTCCTTCGGCTCTGTGGCCACGACCGCGCAGTTCAACCCAGTGAACATCGCATCCAATCAGTTGC
TGGAGAGCGTGGACGAAGCCGCCGAAGCCCCCTTTGCAGGACAGCGATAAGGTTCCAAATAGTGCGCAGCTTCAAGCACCTGGTATAGATGCCAGATGCT
TGAATTCTTTCAATAGAAAACGACGCAATATACGATTATTAAAGAGAAAACAAATGAAGCTAGATTGTCGTGTTAAAGCCTTCAATACGCTTTTAACCAA
CGCATTATTCTAGAGCAACGGAGAGCTGCACTCCGAATTTGAGGACGTATTTCGCCATCGCGCTTCCATCACCCCACTCAAATGCACCAACGTCGTCAAA
GTTGCCCGCCGTATCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTCTCCCTCTTTGTTTTTTCTGGTCTTTTTTTCTCCGGTTTCTTT
CGCGACACATACAGCCACAGCTTCCCTAACGTTGCGTCTCGACGAACGCGC