Description :
From Genome Similarity Track
Location :
Scaffold_52:6466- 7880
Transcript NameFunction/comments
Phyci_311861Hypothetical protein
Phyci_496363Hypothetical protein
Phyci_581045Hypothetical protein

Sequence
1414 bases(100 bases per row)
GATCCAGCGATAAACCAAAGTCCCACCAGTAGCATGGCGGCACTGCGTTTCCAGCACTTGCAGATGCACCGGGCATTTTTGGTGGCAACGATGGCCCCAG
ATCTGATCACCGCGTCAGGATGCGGCGTGGAGACACTACTGGAAGACTACAGACGCGTTTCCCTGTACCATCCAGACCTCGATGTCCAACTCGTGGACTT
GGAGAACTGCTTTGGAGATACCTTCGTCGCCACTACCAAAGTAAAAGCCACGATTTTCGAGAAGACGCTTCAACTGGCGTTCCCGCACTTGGTAAATGAT
CCGGATTTATGGGCTGCCCTGGGTTCCAAACTGCTCGGGAAGCAGCTTATTATGCGTGGTTCCGTGCGCATAATCTGGGATAGCGAGAACGGTCGCGTTG
TGAGCTTGTACAACAATGTCGACCTGCTGGCGCCTCTCTTGGAGATTCTGGGAAATCTGGACGACGTTGAGCGTGTATTTAATCGCTCACTCATCAGGCC
AGACGGGAGCTTGGTTTATGAGAAGAGTCACAACACAGCTAGGGCATAAAGAAGTACGCTTGAAGGACCAGACTCTTCGTAATACTCGTATACATTTGTA
CCGTTTCATTCTATGTCTACCTATCATCTGTTTATAAACCTAAATGAAGCGTTAAATCGCTAGAATCCGGATGCTACAATTGCGGTGGGGGGGGTGGGTG
AACGGGAGAGCCACATTTGTTTTGAGAGATCGAAAGTTATGCTTGTGGTGCTCACGGAATTAGAAGCTCGAGCTCCCTCAAAGTCAATGATTTTTTTTTT
GAGAATTAGAAAACCAAGCTGGTTACGCTGGCCTAGAAATTCCCATAGTGAAGTTGCTTTTGTTGGAGATTACGATATGTAGcaagaatttgtgtcttgt
gatcgcacttaatcggagtggtgtgcgagttttgaagctatttgccgacatggcgacgaagcaggatgctgaagaccttgctagccaggtgaagacggtg
aaagacaatgtcatcggagagaagactgttaagatgtacacccgtggaatatatcgctacgtggcgtggctttacgagaaccagagaagtgtcctgtgcg
atggtttcattgatgctttgcgcgccggtgctttggagaatgccgacttgggtatagcgATAGtattcatttgtgctttaccaaattaccacctcattta
ttacgaactggaggacttcttatgcgtctctagtttatcacagtgaatatctacgcacaacactgagtgcactgcaccctttgttccgcagtgccctttt
cgaaaacgccaggctcgtgtcccagttgcaacaacggctggtttgtcggacagcacgtgcatcggaccgaatgagactcactggggttcctccgcacgtt
catttgctggtagc