Description :
From Genome Similarity Track
Location :
contig_10:646425- 648195
Transcript NameFunction/comments
g2860.t1Cathepsin cysteine protease

Sequence
1770 bases(100 bases per row)
GTGGCAACGCGCCCGATGCGCTGGACCACGGCGTGGCGGCGGCCGGCTATGGAGTCTACAAGAAGAAGGACTTTTGGCTCGTCAAGAACTCGTGGGGCGA
CTCCTGGGGCATGAAGGGCTACATCATGATGAGCCGCAACAAGGACAACCAGTGCGGCATCGCCACGGACGCCTCGTACCCGATCATGACGAAAGGGGAG
GAGACTGCCCTCAAGATGGAGAGCGTGGCGATGGTCGAGGAGACGACGGAGGTGGCCAGCATCATGTGAGCTTGCGAGCGACGGATGCCCAACGCCCAGT
ACGGAGCGGTATAATGCATGTAAAGTTTGACAGCCTCCTCCGACCGGTAGGTCTCGGAGAGATGGATGCTGTTACGAATGCACACGTTGCCGTCTTTTAC
TTTCGTCTTGGTTGGCAGCTTTGCGTAGATGTTGATGGCAAGGATGGCGACGTTTGGCACACGTCGCAGGTAAATCGGACATAGTCGGATGCTACCCTAT
CCTCTCGCACAATCTTTCCAAATGATTGTGCCCGAAGCCAGGGTGCCCAAAATACGTCCCCAAAAGGAGTACAGAAACAAATCTTGGCAAAATGGCATTC
CATAACCAAAATACCAAAGCAGAGTGATTGAAGTATTAGTAGGGCCCACTCTCGATGTTGAGCGAGTGACATAACCATCCACAAGGTTCTCTCGCCTTTC
AAACGATGAATCCGGCATTGGCCCCGCGAAAGACTGCAAGTGATCAACGAGGAAACGCTTTCATTAAGATTTCTCTTCAGTCCCAGCCACCCTCACTCTC
TTACTTTTCATTTCGCCTACTCGTCGGGACTGCCAGCTACCGACAAACCATCGAATCAGCTAGAGCTGCTCGCTTTTACCATGCAGTCCAAGTTTCTCAT
CGTGTGCTGCCTGTGTGCCGCCGCCTCGATCCTGCACGCGACCGAGGCCGGTCCAGCACGCGGACCGTGCAGCAACCTGGACTCTGGCCAGGACTACTAC
GGACACCCGTAGCACCGCCACGACAAGCACTACCGTCGCCGCCTCGCCGAGGACAAGGCCGCTACCGAGTCGGAAGGACTACGACGAGGCTACGGATACG
ATGACTATGACTATGATACAAGGGCTACGGTGGTGACTACGACGACTTCGGCCACGGACACAGACGACTACAGCTATGGCAAGGACGTCTACGACTATGG
ATACGGCTACCCGGACTACTCGTCGTACGGCGGAGGCTTCGGCTATTACTCGGACTCGTACTCGACCTACGGCTACGGCTACGGCTACCCGGGCAACTTC
GGCTACGGCTACGGGTACCCGGGCTACTTTGGCTACGAGTCTACTGCGACGGATGCTGATGCTGTTACAAAGGAGTCTGCTACTGTTGCCGTGATGATGC
GTCGGTCAAGCCAATGGAAACGAAGGAGAGCTAGATGTAGCAAATACAAATGCCAGTTGATAGAGCGATGCTGGCATTTCGTGCACCAGCGTATCCGTCG
GGGATACTTTAAAGCCCATTTTTATGGAGAGCATTTTACGGGCAATGTATCCGGAAAAGCAGCCCAAAACTGGACTATACAAACCGCAAGATCGATTCTG
AACTTTGCGCACTTCAAGCGTCACATCGCATGTGCGGCCCAATTTGGCCTCACTGCAAGTTAGCGCCGCAAAAGCGCAAAACAGGCAGCAGCGCGAGGAG
GTCTTGCCCCTAGCACAGAGCAGCCCGAGCCAGTGGTGGAGGCAGCCGCGAGATGGGATTCAGTAGCCGC