Description :
From Genome Similarity Track
Location :
Scaffold_96:6463- 8076
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.26Cysteine protease family C01A

Sequence
1613 bases(100 bases per row)
GGCAGAGCGCGCAGCACGCCTCTGGGGAGCGGGCCGGCGCGTTGCCGATGTCCTGACCTTCAAAGTCCGAGTTGAACTCGATCTGCTTGCACTTGTACAC
GATCGCCGAGACGAACTCCTCCGAGTCCGTTGACGCGTGGTACGTGGCGGCAGGGACCTTGCGGGTCTTCAGCGCACAGGTGCCACCGTTCTTCTTCGAC
CAAGTGAACGCGTGGCACTGCGCGACGTCGCTGCAGAATGCGTAGCAGTCGTCGGCTTTGCTGGCGGCCACTTCGCTCAGATCGTTACCCGGGTACTCGT
AGCCGTACTCCTGCGGGGTGTTCTGGCGCGTGCACTTGGAGATGTCATGGAACGAGCCCGAGACCGCGTCTGCGCTCGGCACCACGAGCCCGGCGCGGCT
CTTCTGCCAGCACCACCCATTCTTCCACTTGGTGAACGTGAATGCGTTGCATCCCGCGGTGGCTTTGCACAAGGTGCTGCACTCGCTGACCGATGAAGCA
CTCGAGTTGAAGATGTCGTTGCCCAAGAAGTCGACGCCTTCCTGGAACGATCCAGAGGCGGCAGCGTCACCACCAGCCATGGTAGTAGGAGCTGGTGTTG
GCGCTTCGCCCTGGTACGGATCTGGCAGAACTGGTGCGAGGAACGGGTTGGTTTCGACAGGGGTTGGGGCGGCAATGGCTGGGGCAGTAGTTTGAGCGTT
CGTCGGAGTCGGGGTTGGAAGTTCAACCTGGCTCTGGGTTGGAGCAGGAGTTGGGACGCTGGTAGAAACCTTGGTCGACGCTGGTGTGGCAGCCGGGACG
GGAGCCTTCGTTGGAGCCTGAATTGGGGCCTGAGTTGGAGCCACAGTCGTTGAAGCAGGGGTAGGAGCCTGAGTTGGGGCCACGGTTGGAGCAGTCGTCG
GAGCAGTCGTTGGAGCAGTCGTTGGAGCCGCGGTTGGAGCGGCCGTAGTTGGGGTCGAAGTTGGTGCAGCAGTTGGTGCCGCAGTTGGTGCAGCAGTTGG
TGCAGCAGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAGGACGCATAGAGCTCCACGCCACA
AGCACCTTCATCGTCCGAAGCGTAACGACGCTGGATGCGGACGTAGCCCGCCTCACCCCAGTTCGTCCCCCACTGGTTCTTCACGCGCCAGTATGGCGTC
CCGTTCTCTTCACCAAAGCCGACCGCGAGTCCCGAGTGGGCACCAGTCTTGTCGCAGTTCTCGCCAGTCAAAATGCCGCCGCTGTAGTACTGGAACGCCT
TGGAGCCACTGTAGAGGAACACAGACACTGGGCGAGAGCGCACGGCGTCTTCCAGAGCACCAGGGTCCTTGCGGATCGACAGGAAGCCCGTGACGCCGAT
GTCCACCTCAGAGCACGACGAGAGCTTGCACGACGGCACGCTGCCGTCGGACGAGGCGAATGGGTACGACGCCAAGGTGCACATCTTGCCTGCGCGAGAC
TGCGCAATCCAGTCCATCGTGTACGACGCGAAGCCTCCACCGCAGCCCTGGCTCTGACCTTGGTTATCGCAACTGATGAGCTCCTGGTCCGCGAGAACCG
GAAGGCTGGCACC