Description :
From Genome Similarity Track
Location :
Scaffold_85:64622- 72469
Transcript NameFunction/comments
Phyin_T30-4PITG_19319Putative uncharacterized protein
Phyin_T30-4PITG_19320Crinkler (CRN) family protein

Sequence
7847 bases(100 bases per row)
TCTGGTTCTACCACATCTGCCATCAACTCGTATCGTTCCATCATCTCCTCTGCACGAGCATCAACCGGCTGGGGCAAGAAGTCATCAACTTGAAAGATCC
AGGCAAGAACGACGGAGGAGGTGGGGCAGACTCCGTTCGTCTCAGTACGGCTACCTCGATAAATCTGAACGCGTTCTTCGGATACTTCAACGTAACTTGG
GTCAGAACGTGCTTGTCGCTGAACCAAGAGAAATGCCAGTGGTCGTTTAAATCCGTCAACAAACTCAGCGGATAGCAATTGAGAGGCGCCTTCATGCTGC
AGCTCACAAGCTGACCAATTGCTAGAGGAACATGGCCCGGTTCGACTTTCTTCTTGAGCTCGATCACCAAGCTGACCCCAGCCAGCTTAATGGCTCTCCC
ATAGAACACGCCCGCTTTTAAGAAATAATTTTCTAAATTAAAGAACACCTAATTTGACGAACTAGATTTATTCATTTCTAATTAGCTGACTTGGGTGGTG
CGTCCGCTTGCGATCTCATGGCGGCGTCGCGACCTGGACCTGTCTGTGGCGCTGCGCTCAATGGTATTCGTGAACGAGACGGTATCGTTGCCGCCGAGGC
AGTTGGTGTCTGTGGCTTTGGATCGCGCGTCTGCGTTGCTGGTCGGCGCTCTGGACGTGCAGAGCGTGAGCATGGCTAGCCTGGCAGTTCCTCGTTGGAG
CGACTTCGTGCTGCTGCACCGCGTGAAGAACGGTGGTGAATGGCAAGTGTCGGGCGAGTTGCAGTCGAGCGATGCGAGGTGGCTGAAGACTGCGGAGGTG
GTTCTGGCGCCGCGCACGGCCAAGTCTCAGGCTAGCCAAGTCTCAGGCTGTGACGGTGTAAACGAACGTGAGGCTCCGAACGTGACACTGGTGGACGCGG
TGTCGTCGCAATCCGTGGTGGTGGAGGTCTCACACTTGGTCCGGAGCATACCGGACCCAGGCTGTGACGGTGTAAACGAACGTGAGGCTCCGAACGTGAC
ACTGGTGGACGCGGTGTCGTCGCAATCCGTGGTGGTGGAGGTCTCACACTTGGTCCGGAGCATACCGGACCCTCGGTCTCTGGTGTCGACTGCACTGCTG
CAGCCGATCGTGGTGGAGAACCGGGAGGACGAGCCTGCGTTGGTTTCGATGGCGGACTTGGGCGCGTTGGTCCGCCAACGCGACTGCAAAATGAGTTAAA
CTGTGTGGCAGTGGGGGCCGTAGCGGGCGTATTTTCAATTCGTATACTAAAACGAAGTGTAGTGGTTACGGGGTAGTGTTCAATTGGGCGGGAAAGCGGG
CTTGTTTCCTGAGTCTCGCGCCAAATCAATAAGTGCCAATAATGTGGTACACACATGTAACATTGTTTGTTCAGATTTAATTTTATTTTCAGATTTAGAA
TTAATCTGTCAGATTTAGAAAAGCGGGTGTGTTCTATGCTTAATCAGTGGGTTCTTCGCTGTTCGATTGATGAGCAATACATCAGCTGTGCCTTTCATAG
CAAACGGAAGTCTTGGGTCCACGATGTTAAGAACTGATTTATCGCCCGCAATGTCATCCAACAAGAAGTCTCCTCGATCGATCAGCGTCTTCAAATGCTG
CTGCAAGTACGCCATGTACCCAGCCCTTTGACTTTCCTCGCTCTCCACGATTTTTGGAATCCACGAATAACCGGCGATGGAAGTATCGACTGGCTCCTTG
ACATCAGGAATATTTTCGGTCAAGCGCATCTTCTTGACAATTCGCTCTTCCATCGCAGTATTCAGATCGGAAAACGAATACGCAGACGCCTTCTCATCTC
GTTCCCTGAGGACCTTATTCATTGACATCTCCACTTGCTCTAGAGTCAGTGGCGTTGTCGCTGCAGACATCTCTTTTGAGATAGTACCGTCTTGCTCCGG
AACCACCACCAGCACGTGAACAGGTGTGTTCATCGACTCGACATCCTCTAGAGTGGGTACGAACTTGACGTCCTTCTCCGACAAGCCAACCAAGCTGAGC
GGCGCTCCTGCAACGCCCAATAGCTTCAAATCACTCGTGTCACTGACACCGTCCTTCGCGTCGTTCTCCGTTAGCCACACACCAGCGCCTTTCTTCTTCT
TCGCCAGGAAGAGCTGCAGGTTCTTGGCGTCGCATGTGATCGTCGATGCGTTCTCCTCCTTCACCGCCTTCTTTAACGCGGAAACCGACGCACTCTCGTC
TATGTCCACCTCGAATGCGCTTCCCGCCACACCAACAATCGCGCAGAAGGGCTTCACCATATCTCTTCGAGCCGGAATGAGAGAAAAGGGGATAAATAAT
GCTCCCGTACTTAAGCGGGAAAATAAGGTGGTGTCACAGAAGGGGGGATAATTTTGCACCCGTACTCTGCATTTTATCCAAAATCCCGTGATAATCCAGC
GATTTCGTTTACCCTGCCATAACAGATGAGTGCTCATTTTAAAAAGCAGCCAAATAATAAATGCACGTACAGACAACGACCCAAAAAGCCGGAGTTGATA
AACACAATTCCGATAGTAAAACCTGCGACACAAAATCTCGTACGACTAGCAAAACATGTTTTGATTGGATGAATAAAACTGAGAGTATCTACCCCATTTG
CCGCTTCCTTACCGAGTAACCTGTCGGTCTGTCTGTCCGTCTGTCAATCCGTCCGTCGCACTCCCTGTCTTCCTGCTTTGACCTGCCTTTTCGCATGGCT
ACACTCGCCCTTTCTAAAGCATTTGGGTCCCATTTTATGGACGGCGCCTATCTTTCTGACTCGACCTAGCTATGCCAAAATTACAATTATAGCAAAAACG
CCACACAATTAACTCGCGCTCTGATTGGGCAATATTTTCCGACTCATTTCTTATTCAAAACACAAAATTGGATTTTTTAGCGACGGCGCGGAGAGGACAA
GTTGCGCTGGCTGTATAATAGCAGGAGGGTAGTTTTAGATGAATATGCATGTATGTACGGGCGTGGGGCTCCTTGCCCTATCATATATTCAAGAGAGACC
TCTCAGGATACAGTCTGAGGCTTGCCCCGAGACTCCAAAGTGGTATGGCAGTTGGTAGCGATAGCAATCAGGTTGGGGTGGGTGTGACTGGGAGCGTCTA
CCACCATGCACGCGCCTAGGGGTCCTAGACCCACCGCGAGTGTCCACGCTCCAAAAGCGAGTGGCGCGTGCTGCCAATTGGCCATACCGAAGTTGCAGCC
ACATGCGGAAGAGTCGTTACGGTCCCGCAAAACAGAGGTGTTTTTAAAGTGTGAGCTCCCACATCAAAACACACTTTGCGAGAGCACTTCTGGCGGGACG
GAAAGGAATGCAGCAGTCGGTCTCACAAGAGCAAGGAGCCCAAGACCAAGTGCAAGGACAGCTCAAGAACAAGAGATCAAGACAAAAAAAACATTTAAAG
AGCATGAGTGAGCCCCGCGCCTGTACACTTAGATATCATAGCGTCATAATAGACAGTTTTAGAGCATTTTCGAAATTGTGTGAGCCCCGTGAGGGGCTGG
GTCGATCTCGGACACCCTGTGCATACTACTGACATGACCTGAAGGGCTGGACGGTATCGAACAGACCTGGGCAACCACTCAACAGGGCTGAGGCAACAGC
TTTGACGTACCCAAGAGGCAACAGCGCGATGCGGCGTCTGAATTACCATGTACAGCTGCTTGGTCCACAGCCGTGCCAGGTAATTTGGACCCGTCGGACC
GTGAGCTGAGGGCTGTAACACGTCGGCCAAGGGGAGGGCCTAAGCAAAAGCTGACTGGACCAACAAGCCCCCTGGAGTGACGATATTCCTAAGTTGTTTG
TAATCCGAGGAGCCGGGATGGAAATGACAGTGATGTGTTCTATTCACAGAGGGCTTCTGGATTAGTACTGGAAAGGAAAGTTCGGGGTTCTATTCGAATA
CCACGTTGCTTAAGCTACTGTGTCCATGTTCTGGTGCTTATATTCATGAAATAGCTGTAGAATAGCTCCCGGTGCACATAGACTTTCGAGTCTAACCGCC
CATGTAATTATTTTCCATTTAAATTAGGCGACAGACGCTTTTAAGATAGAAGGGCATGGCAAGAGCCCCGAGGAAAAGAAAAAGGTTCCCCAACAACTGT
GTAGCGGGCTTTTGCGCAGAAGTAACTCGACTAACTGTGTCTAATTATTAGAATTACCCGCGAGGGATTAGATGAGCGCGTACAACGAGCCCGGCGTGAG
AACGCATCCCAATCCCAAGAAGAGTCGCGTAAGGAAAGAAAAATCCGCAAAAAAAGGCTTCGTGAAGCGGAAGCGCGGTACCGCAAGGCAATCCAAGAAT
TGGAGCAGCTTGACTTAGTCGAAACACCAGCACAAACGGGAATCGATCAGCTGCGCGTATCTGGCTTAGCCGCTGAGCGTGAGGAGAAGACTGAAGAAGA
TGACCCCGTTGTGCATCAACGTCGCTTCGAGGAGGACTCGCATCGCGAAGACCCTGTCGATAACGCCTGCGGTTTCCAGATTGGAGTGTCAGGGAATGCA
GCTGACGATAGAGCTGCGGCTAAACGTGCGCGCGATGCAGAAAGAGCCCGGGTCAGGCGAGCTGCTATGACGAGCTCGCAAAAGCAACGGGCACGAGTGA
AGGACGCCGAAAGGAAAAGAATTCGTAGGGCTAACAGATCCGAATCTCAGGTTACCCGAGATCGCGGTCAAGATGCCGATCGAGCAAGGGTACGGCGCGG
TAGAATTCCACCAGAAGAGCTTGAAATTCATCGAGAATACATTCGAAGCACACAAGCCATTCATAGAGCCGCAAGTACAGAGGAAGATCGCCTAGATGCT
AGGATTCGCGATGCGGCGACACATGAGGAACGCAGGGCGTGCATGACCGACGAACAGCGTCACGCCGAGCGTAGCCACAATACTGCATCACGAAGAGAGC
ACAGAGAGGACATGCCCGATGTGCAGCGACAAGCGCGGCGTGAGCGAAATGCTTCGGGACGACAAGAGCACAGAGATGGCATGTCTGACGAGCACCGACA
AGTAGAACGCGAGCGAGATACGGCAGCGCATAGAGATCACAGACGATGCATGTCAGAGGAGCAGCGGCGAGCACAGCGCACCCAAGACGCTGCCGCGCTT
AGAGCACGGAGGGAAGCCATGACGGATGAACAAAGGGCGCAGCCAAAGGAAAAAGAGCGGTTTCGAAGGCGGTCTCGCCAGTACAAGAAGGGCCTCGCAC
ACCACGAAAGTTTTGACCCTTCCAGCGTTTCCGGGGGGGGGCGCCACTACTTTACGCGTTACACTAACGACAACGGGGAGAACGAGCGAATTTGTCACTA
CTGCAACGCTTGGAAGTTTCCACAAGAGACAGACGGATGCTGTTGTCGTAACGGACTGGTGTTCGTTCCGACTTCGCGAACAGCACCTGATGCGCTTCTA
ACACTTTTTGAAAACCCGACTTTCATGCGGTCAATCCGGGCCTACAACAACGTATTTGCATTTACGTCCATGGGAGCTTCGCGGTCTCGGCCTCTTAATG
TCGACGAAAGCGTGACACGAAATGGTGTCTACAACTTCCGTGTACAAGGGTCAGTGTGCCATCGCTTGGGATCGTTACTACCTCCTACCTTCGGTCGCTC
CATGTATGCCCAAGTTTACTTTAACGATCCGGACATTGATGCACGTGTGAGAAGCCGTATGAACATGACCCATGGCCTCGATCGCGCCGTTATGGAAACG
ATTGACCAGATGCTAGTGGCGCACAATCCGTACACACAAGAATTTATCAGCGCGCGTAGAGTTTTGATAGATCGTGGTTGGGATGAGTATGCAGCTGCCA
TCAGGGAGCACGAACGACGCCGAGCGGCAGGGGAAGACGTTGATGAGCATGATCCGTCATTAGCCTTGAGTAATTTTCTTCCGGAGGGGGATCACCTTAA
GCTGCGTCTGCATGTCACACGGAATGCAAACCCGGGTACGCATAACACCCCCACTGCATCAGAGGTGGCAGCCGTTGTGATCGATACAAACGCGGCTGAG
CATCGGGATATAATCCTACACACGACAGGAGGGGGTTTCAAGCGCATATTTGAGACGAGCGTTACCTACGACCCGCTGCAGTACCCTCTACTGTTTCCGT
ACGGGGAGAATGGCTGGACTTACGATATCCCGTACGCTGGTAATCCCGTCGATCGCCACGGTGACCCCTTAACCATGTCCGTTCGGGAATATGAGGCGTA
TCTGCTTTACGACCGGACGGTTAGTAATTCTCTTATCCTGCGCGGTGGGCGACTGACGCAGCAATACTGCGTTGACCAATGGGCCAAATGCGAACAAGAA
CGCCTGCGCTTCGTCAAGAAGAACCAGCTCCAGTATCGATTGGAAACCCTCCAGGGCCTCACGGACGCGTTGCGTGGCGAGTCTGTTGTAACCCACAGAA
TGGCAGCTGACGACGAGGCGGCCATACGTAGGACTCGCCGTGGGAATAATACGGAGCAGGAGTCAGCGAGGCCAGATGCGGGTGAGGTTGGGCGCAAGAT
CATCATACCTCCGAAGTTTACAGGTGGACCCCGCTACATGTACCAACGCTTCTTGGATGCCATGGCTATCGTCCGTGAAACAGGAGCCCCGAGCCTGTTC
ATTACGATGACATGCAACCCGAACTGGCCTGAGATCAAGGAAAACTTACGCCGTGGAGAAAAAGCATCCGACCGACCGGACATCGTGGCTCGCGTGTTCA
TGGAGAAACTAAAAGCTCTTAACAAGGATCTCGATGAGGGTGTACTGGGGATTCAAGCCGCTCGAGTGCATGTAGTGGAATATCAGAAGCGTGGTCTTCC
CCACGCCCACATACTGCTTATCCTGCGTCCGGAGGACAAGCCCACTACCAAGGAAGACGTCGATAAGCTGGTGTCCGCGGAGTTCCCGGATAAAGAGAAG
TACCCCGAGCTGTACGATACGGTGATTTCCAATATGCCGCATGGATCCTGTGGTCAACAGAACCCGAACTGCCCGTGCATGAAGAACGGAAGGTGTTCCA
AGAAGTTTCGAAAGGCGCTCGCGGACGAAGCTGTGATGACCCTCGACAAATACCCCACGTACAAGCGTGGTCGCCGTCCGGATTGAATTTTGTGCCATAA
GGGGAAAGTATGGGACAACGCGACCATCAATCAATGGGTGGTCCCGTACAATCCGTTCCTGTCGCAGAAATACAACTGCCACATCAACGTAGAGGTTTGT
GCCACGAACAAGGCCATCAAGGTTATCTACAAGTACGCCTACAAGGGCTCGGACATGACGACAATCACGATTGAAGGCGAACGAAATTCGGGCGAACGAA
ATTCTTCAGTATCTCCTCGGGAGGTATATCTCTCCGGTAGAAGCTTGCATGCGGCTATTCATGCATCCAACACAAGGCTCAACACATTCTGCCGTGACGC
TACCTATCCATTTGGAAAGAATGAGCATGGTCGCTTATCGCGACCAAGCGACGACCCCCCAGCTTCACAACTTGATTAACCGCGGGGACAGATCAATGCT
GACGGAGGTTTTCAAGCTGTGCGCGCGTAATCCAGAAGCTACGGCCAATCTACTGTACAAGGATGTACCGCGGAAGTACAGGTGGACGGAACACAAGACG
TGGGAACCGTATAAGAAGTACGTTGCTTCTCGGGGACGCTTGGTACACGTATCTCCGCAGGACCCGAAACGCTTCTACTTACGACTTCTCCTGTGTAACC
GACGCTCGCCTAAGTCCTTTGCGGATCTTCGAACGGTTGATGGTACGGAACATCCTACATATCAGCAAGCAGCTTTGGCGCTTGGATATTTGGAAATTGA
CGATGAGTGGATACATTGCTTACGCGCAGCCACCGAGGTCAAGATGC