Description :
From Genome Similarity Track
Location :
Scaffold_789:6462- 10923
Transcript NameFunction/comments
g15928.t1hypothetical protein

Sequence
4461 bases(100 bases per row)
CCCCGATCGGCCTCTTCCTTCCTCGATCGCAAACTCACAGTTCACAAATTACCCCTTCCTCCGATGTGCGGCCACCCCGCACATCCTTCACTCTCCTCCT
CCCCTACAGTGCCTGTTACTGCAGGAGGTCTTCCGCTTCTCCTTCATGGGACTGCATCACTTCAAATCTGTTCAGTCCTCATTCAAAACCGTGCAGCATA
GCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACCCGTCCATAGCGCGTCCGGC
GGCCAGTTCTTACATCTGCGATCTTCTCCACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCTTCCGACAGGAGGGCTTCATCGAAGTCCAG
GCGATCGCTCTCGGTCACAAGCAACGACGTGTCAGAACGATCGGGGGCGTGATCGCCGATCATCTCAGCGGCACGAAAAGGTCCATGCCACAGGTGTGCA
AGCTTTCGTACATACCCCTCCTTGACTCGATCGAGGTGCAGCCATACCTGAGCGCCCACCGCGATGTTGTGGGGCCGTAGATCTTCGTTGTGCCGGTTGG
CTCTACCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATC
GCGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCCATGGGCCAGGTAGAATGGCGTGTCACCACGAACTCGATCC
TGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTCAGAGTCT
GCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTTGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGA
CATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCGATCGTTTGGGCAGTGCGA
GAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGT
CCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGGGGGGCCTTTCCCAGTTTCACAATCCACACAT
TCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACACGCTGGTAAGTCCTTCCCGATCCCTTGGTGCCCGCCTTCC
AGGCTAGCGTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCG
GGCAGAACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACTTCGCCCCG
CAAGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTGCAGAACTTCCGGC
ATTCGTCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGCTACAACGTTATTATACCTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGA
TCAGGTCCTGTCGATCAACGTACGAGGTAACTACTGTTCCATCGCCCCGTTGAAGAGCTTCGCTAGCTAACTTGTCTGCGCTCTGGTTCCAATCTCGTTT
CATATGTAAGAAATCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGC
ATTTGCCGGATCACTAAATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAAGAGATCGAAACACAACAACAGTCCGCGGTATTCAG
CTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATTCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCG
TTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCCTCGACCGTAGGGGGTGGCATGGTGATCGTCTGTCGGGGCTGCTTCACT
GGCGCAATCGCGATCAACGTCTCGTCTACTTCCGCGCGGGGTGTGATACTTGCTGCGATCGCTCCCAGAATTTCATCCTCCCCTTTCGTGCACTTCCTGA
TCTCTAGCGTCCATTCTGATAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCCAATGTCTGGACAG
CACCAAGATTGACCTCGTCGTCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGCCTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTG
GGCTTCAGAGTACGACTGGTAAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGA
TCACCGGGGTGCGATCTGGATTGAAATGTCTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGTTCGGGCCCAACGGTC
AGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTTGCCGGGGATGGACCTGTTCTGCTGAACCATCTCGTGGAAATCCGCTTCGCGCAGCTCG
TACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGG
GAATGTTGCCTACCACTTCAAGGTATTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCCCAGAAACT
CTTGACCACGCTGATGGACAAATTCCATCGCTCGCAAGCGTCGAGCAATGCCTCTACCTTCTCACACAGCCTGTACCAAGTGATCGCAGTCACCAGAATA
TCATCGATGTACGATCGCCTTTCCAACGCTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTCCGACGGATCGTGACCGG
CGCGGATTCGGAAGTGTCCATGTAGCGCGTTATCAATCAATCGCTGATAGACCTGTGGCGCATTCTTCAACCCGAGAGGCATACGCGTCCACTCGAACAA
CCCGAACGGTGTGATGAACGCAGAGATCCTCCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACT
TTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTCGTCAAACTATTCACCATCCTGTAGTCGATACAGAGCCGGATGT
CAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAAGCCCACGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGA
CAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGGCACGTTGTGCAACAGGAGCTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCATCTGGT
GGCAACGCGTTTCTTTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTGTCGCAGGCGATCCATTTCTTCCGGGGTGTTTGACTCAGGATCGCCCA
CCTGGATATCCTCGATCGTGACTTCATCGATGATGGTCACTACTTCCGGCAAGATTGCCATCTGTCTTTCCACATCTTCCGCGAACAGGTCGCCACCTTC
GTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCGGCCCGGGGCACAGACTCCTTCTGGTCAGCAGTCATCTCGCTT
CGTGTTGCCTGCTCAATCGGTGGAGATTCTCTCGCGGCCTGATCGCTGGCGTCAACTTCCTGATCCCTTGGAGATCCCTCAGTTTCTGATTTCATCTCGG
CGGGTCGAGGCACGGTTAGTCGTGCGACGACCGACCTCGAGGTTTCACAGTCACGGCGCAGGATTTTCCTCGGTGTGTCGTACTGAGGTCGATCTACCAT
GGGTCCGGCAGGAGCGAGTTCGGGTTCTTCTACCTCCACACGGTCTGTAGTGGACTGGAAAGCCAGATTCTGCCACTCGGCATACCTGCGCGATCCAGGT
AACACGAAACCGGGAGTGCGAAGTACGCGTCCTCCTTCAAGCCACATGCCAACGTGGGTAT