Description :
From Genome Similarity Track
Location :
contig_38:64610- 94774
Transcript NameFunction/comments
g7057.t1hypothetical protein
g7058.t1conserved hypothetical protein
g7059.t1hypothetical protein
g7060.t1conserved hypothetical protein
g7061.t1hypothetical protein
g7062.t1hypothetical protein PHYSODRAFT_321958
g7063.t1conserved hypothetical protein
g7064.t1hypothetical protein PHYSODRAFT_552012

Sequence
30164 bases(100 bases per row)
GCGTGGCCAGTATGACACGTTTCCAGATCTCATCGACTCGCCGTTTCTTAACTGGTTCTACTTCTTCCACTGTACAGGCCCTGGTCGTGCTGAAGCTCCT
CATTCCGTTCGTGGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGTGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTG
TCACGATATTTGCTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACT
CCATCGCAGAATTTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAA
AGAGTATGATCTAGTAGACACAGTTGGAGACGATAAGGTCCGATAGATGTCCAAGCTTTAATTCAAGACCACATGGCCAACTTAACCGAAGCCGATCCAG
GTTTGTGCTTGAATTATTTGCAAGTAACCAGTTGTGACCAGGATAGTTCAGAGGCACGAAGTGAAGCTACCAGCTCCACGTTTTCGAGGCCAATGAATAT
TCACGCGCGACACGAGCTTTGGCGTTGGCATGGACAACTTTGCAGTCGAGTCCGTGGCCGCGGAGGTGGTAAAGATGAACTCGAGCACGCCCGAGTTTCA
GAACAACAAATTCCACGGGTCGCTCAAGAACACCAAGTTCATCAGCATTCGCTGAGTTGTCGAAGCGGCCTCATCGCCATCAGCAGCAAGATCATTGTCG
TTTTCTCCCTGGTAGAATCTTGCTTTTGGTCAATGTTGCGTTGGCTTAACCACGGTGTAGTAGCGGTCAGCATAACGAGCAGAGGCCCCAACAGATCATC
ATCCCAGCTTACGGAAAGACAACTTGGTTCCCAAAGAGCTCCCGCGGCACTGGGAACAGCTGACCGAGCGAAAAACAATGGATCCGGGACTGTATCGCCT
TTCGACTGTGCTTTCGCCTGAGTGAAGTTTGTTGGTTTGACCCATCGGCGTCGATGCCAACGCGTGAGCCCCCGTACCGTTAAAATGACGAACACATAGA
TAATTGCAGCAAGGGCGACGGCCAACATATCGCTGTAAACGCCTTCGAGGTTCATTTTCCACCCATCTAAAGTCTCAGAGCGCAGCAGCATAAAGGTTGG
CACTGGCTCCACCTCATTGGCCTCCAAGATCCTTGCGTCACGGTCGTCGACAGCTATCCCTCCATGTGCTACAAAAGCCACGGCACCGAGTGCTAAAGCG
GGTAATAGATGACCACGCACACCTGAAACGCCATGCGAAGGAGTCCAGGCACCAGCTGAGGTCTGCAACAGCGCTCGGAACCGTGCCAGCAGCGCCATAA
GCCAAATACATCGCATATGGACAGCCAACCAGCGCGTTAGTGCTGAAAAACTCTCCGTCGCGCTTTCTCCACCGTCATCTTCCAGTTCGTAAAGAATCAA
GGCGTCGATAATATGTGCACTGCGTAGCAGACTACGGGTAACCAACTGCCATACACCACAACTTGGCTGGGGATAGCAAAGAAGACACGTAGAGCGTGCT
TCATTCTTGACGTATCCGTGCCGTCTTCTGACCAACATTTTTGTCGACAACGGCAAAACAGGCGACAAGCAGACACACCACTCGCACGACGACGTACAGT
TGCCCGATAAACGCAGTGTTGATGCCAAAGAGCTCCATTCGAGGGCGTCAGTGTAGAGGACTTTGCCCTCGACACGCTCATCAAAAACCGCTATCGTCTT
ACAGACACGTGCGTCAGTGCATTGTCGAATCCGGTAGAGTGCCACAACATTGTAAATCTTGTGAGCAATCAAAACAGCCCCACCCAATCTTGTCAACGGG
TCCGATTCAGCCTCAACTAGCGTGACATCGAGCTTTTACCATGTGCTAGTGTTGCTTGTAATGCTGCAGCACGCGATGACACAATCTCCCATAGTGCTTC
GCTTTCGGTATCGTCGACGGGTAGAGCAGCAGCCCACGGTTTCTCGCAAAAGAGCGGCCGATCCAAGTCGTCCACGCACAAGTCGACTCCAGGATTTTTG
GTGTCGAGATCGGTGAACGTTGTAACCCAAACGCTGAGCCAATACTTATGATCCAGCAAGTTGCGTGACAGAAAGCTGGTGCTGCTACTCGCAGCAGTGG
AACCAGAACCCGCGCTACTCGTACCGGTCCAGCGAGCTTTAGCACGAGCTGAGAAGCACACGCGTTGGGGCAGCGAACTTAGTTCGCCTCGTGCCATGAT
CGCGATGCCTTCTTCTGTTTGAGCCACATTCTTGTAGCTTGTAGTGCTTGGAGCATTGGCCGCCACCGCCTCGACAAGGGTATCGAGCATGTTGAACACT
GTTACTGCAGGCAGGGAATCGCCACAGTCGCTACTGTACGACGCGCCCACGGAATGAGCGCTTAGTAGGCACGTCGGCCAGGATGAATCCAGCCTTGGGG
ACCCCTCCAGCAGATCACGAACGGTGCGTAGTCCGTAGGAGCTTGGAGTGAACTTGTAGAGCGCAGTGGATACCTTTGAGCTGCTGGCCGAGACTCCGTC
TGTGGCCACCGTGCCATTTTGAAAGAGCGTTTGACTTGGTAGTGCCGTGGGTCCGTACACCGTGAAGACATTTGGCTCGATCTGAACAAACGGAAGCGAC
GTCACGCTCGATCCCGCACGCGGCACATCGGAAACGAGCAGCGCGTACGCGAAGAGAGCCAGGATCACTCGGAGAGCGGTGGATCGAGGCAGTCCCTCGA
CGAAGGTAGCCGTCTCGCGTGCACCGTCCGGATGCATCGCGTGCAGCAGCAGCGACGAGCGTTTGCGCTGCCAATTGTTTTCGGTTGGTACAGCAGAGGC
CGACGGCGCTCCGGATGGCTGGGCACCAGGTCCGGCGGGTGTCTTAGCTCGAGTGTCGCTGTTGAAATCCGGATTCGCCTCGACGTCCTCAGTTTGGTCG
TGCGGCGACATGCGTTCTTGGACTGGTGCGGAGACTCGAGAGCACTGCCGATGCCCCCATCGCTAGTGGCCATGACGGCGGATCCGAAGCTGCAAGTATT
GGGAATGCCGACTGTTGCCCCTACTGCTGGATGGTCGGCGGTTTCGACAAAAGATGCCAGCTTCGCTTGTAATGTATGGCCATGTTTCTGCTGCAGGAGT
CGGCATGAGGCCTGGCCCTTGATGTGAAGCTACTGCTGGAGACGGTTGTACCAAGTCACAATGGACTCGAGCCCCGAAGGGCTTTTCGTCCGACATGGCT
ACATCTCGAGACACTGTGTCCACGTATTTAGTGCAGTAGCGGATACACATGTACTTTGCCACCCACCACTTCCTTGCTGAGTCACCCACTTCCAGCGGAG
TCTCCAAGTTGGCGTCTCCGAGCTTTATCGGTTGCATGGCCTCCATGGTTAATGCCCCATAGTGACCGCATCTCCGCTTCTCGCTTGAAGCTTACGCCAC
GCCTCCAATAGCCAAGTGCACCATTGCACCATGAAAATCCATCGCAGCGTGTGACTTGCAGCGGCCATGTGGGCGCGGTATGGGTTCATTTTCGTCCAAT
CATGTCCCGAAATCGCGTCCCAGAGCCGGCATCTGCCCAGCCACTTCATTCCCGGACTTGCCATCGCTCGACCAACTTGCCGCCCGCCATGAGCATCGAC
TGGTCACTTGAGTGCTGCAACGACAAGCAGTTCCTGTCCATCTTCCTCATCATCTGCTACGCCGTCGCCATCTTCAAACTGTGCGGCCATCGATAGGTGC
TCCACCGAGCTGTTTCATAGTCTTCTAACCTCCTTCTCTTTCTCCCAGATGGCGCGTATCAATCCTCCACCCGTTTAAAATCCTGTACGTAGCCATTGCT
GCCGACGATTTGAGGGTTTCCTTATAGCTGACTGGGTTGTCGTGGCTGCAGAACGGTCTTCCTGCACGAATTGGGGCATGCGACGGCTGCGTGGCTCACT
TGCGGCAGCGTACGAGACCCCCGACCTAGTATGATATGAAACAATTGACCTGATGCGACTATTGCCGCTTTGCCCATAGGTTAAAGGAATGGAGGTGCAC
CCGGACGAGGGCGGTGTGACCAAGACTGTCGGCGGACTGCAGTGGGTCATCCTCCCAGCTGTACGTCGCTGTGGGGAAATTGTGCTTTTGGCAATGTACT
GACGTCGTCAATTGGTGGCAGGGGTACCTGGGATCGGCAGTGTGGGGCATGGCGCTGATGATTGCGAGCGCTGACAAGACTGCGTCGGAGGTGGCAGCGG
GCGTCCTCGTCTTCTTCCTGCTCATCTTCATCTTCTACGCGCACAACGGCTACCTGAGGATCCTAAATTTCTGCTTCATCCTGCTGCTCGCGGGCTTGCT
GGCACTCAACATTTGGACGACTTTCGACGCGCTGCAGTACGTGACGCTTTTCCTGGGCGTCATGAGCTGCCTCTTCTCCGTGTACGACATTTGGGACGAC
CTCATTTCGCGACGAGTGAACGAGAGCGACGCGTCTGTCTTTGCCAAGATGACTCATACGTCGAGTCGCTGCTGGGGGTTATCTGGGGCATTATCGCGCT
CGTCTCGCTCGTCGCTGCCGTTTATTTCAATTTGCTGGTTGCACAGGACTCTGGCGAGTCGATTACGAACATCTCCGACGCCTCCACAGGCACGAAGATC
GCCCTTGCCTGCGCCGTTATCATCGTGGCCCTCGCCGTGCTGCACACTGGATTCACGCGGAGATGTATGCTGCGCAAGCGTGAAGGGTTCAGGGGCTACT
TCTCCGCATAGATATTATCGTGGCGATGCCAGTACTCGAGTGCCTTCATTATCCGGTACTGGGGTGCGTTTTACGCGGTGGAACTTGGGCCAAATGATAT
TTCTTCGTCTCCGTTGTAGATTTCTTTCCTGTGTCGTTATCACTCTTTACTGATGGCGCTGGAAACCAGGCCACACTTCTCTACGATATCTACCAATACA
CTGTACCTACCAACTCACTGCGAGCACGTTCTAAATGCTTAAGGCGTCATCCTCAAAATCTCTTTGTTCGGGTTTGTCTTGCTGCCTTCTTGCCATCTCT
ATGGAAGGATGCCGTTGGTCATGCGCTGGAAATTGTCGTATTGACGAGTGCTATAGTTGTTGTTGCTCTTGCGGATAAGTGATAGCACGTGCGCCACGGT
TTCTTGCTTGGATAACGACAGCTTGAAGCGTGAGCGCAGGCGCAATAAAATATAATCAGCGTCGATGCCCAAGAAGCACGGGTATGGCGACTGACGTGAC
ATAACATCCACGAGGTCACAGATCTCGTCACAGTGCTGTTGGCACGCCAGGAAACCCCGCGTGCAGAGCGTAACATACTCCTTGAAGCCTTCGGAGTCTT
GGCCACCCATAGTCTCTACCATTTCGGCCGTCAGTTTGAACGGCGCCGTCTCGATGCTAAGCATTCCACCCGGAGCGATACCAAGCAAGAAACCGTAGTC
GATATGGATAATATGGCCTTCGTTGTCCAGCATGATGTTGCCATTATGCCGATCCTTGATTTGAAGGAAGTAGCACACAATCGAGTATCCTGCCATGGAC
TGGATGTATTTCCGTTGTGCTTCCTTGAATCGATGTGAATCCGGCGGTCCGTAGGACTTTTCAAAGTGATGAAGCAGAGAGACATACCCTTCACGCTTCT
TCAGACCATCCAGAGAAATAGCGTTGATGAGGGTCTCAATCAGTCCCGTGGACGAGCTCGTAGCGATGATGCGGTACCTCTTCACCCACATAGGCAGATT
TGCTCCCCTGAAAATCTCGACAAACTTCTGAATCAACTGCAGAGTAAACACCTCCTGTCGAAGATCGTCATTACTCTTGCCAATCATTGACACGATATCC
CACCCAGGTAGGTGCCCGTAAGGTGATGCGGCACACAGCCTTGTTCGTTTGGAGCTCCACGATTCGCCAAAGGCCGCCTCGAAGTCTCTGCGGCGGGCCT
TTTCACGCTCCACGGCCTCTGCAGTCAAATCACCCGTAGCCAAGTCCATTTCCAGTGGAGCTGTCGGCGCACCATCGGTTGTCGTTCCACTATCCACGGT
AGCGCCCACGTATTTTCAATTAGTATCGGAGGCGCCGTTGAAGGTGTAGAACAAATATCGGGAACATCAATAGGCGTCTCAGGAACTGGGGCCCGGCGAA
TTGCAGCGACTGGTGTTTGATATGGTTCTGGAGCGATAGGAGGAGGAATTATAGTTTCAGCTTGGATTTCCTCCACATCATCAGCTTCTCCAGCAAAAGC
TTCACTGGCTTGGTGACCAATCAGCTGACCAATCTCATCGTCCTCGACGTAGTTGACCTCAGAAGATTCCAGCGCACCGTTTCCGTTCATATTCTGCCTT
GAGGGAGACCGCGGTGATTCGGGAAGCGAGGTATCTTGCTGTTGGTCGTCGGTGAACGGGTTGCCACGAATTACCTCGAAGATCAGCAAAATAGGAACGC
GAGCTTCGTCGAGAAAGCGGTGCCTTCCTTGGTAGGTATCCGCACAATACGTTCGAATGGGTCTGTTGCCTTTACCAACGGCACATACGCCATGGGAGGG
AGATGCAGTTTCTCCAAATACGATGGGAGTTGTTGTTTTCGATCCTGAATGGACGGCACGAAGCGCAGAGCCTCAGCAATGTCAGTGATTTGCTCCACAA
AATCACATTCGTCAGCGAAATGTTTTGCCAACAAGTGCTTATCCGTTTGGCTCATTCGACGCATAGACTCACTGAAGATGCTGGTTGGCTGGTTATCGGT
GTCCTCTTCCTCAAGAACCGACAATCGTTCATCTTGTTCATAGTCGTTATCTGTAGGATGCGAGATCAGCATAGAATCAAGGTCTTCCTTGGGTGTCAAC
AAATGCTGTTGGAAGCGCGAAAAATCACGGAATCGACTATCGACATCAGCATCCGACCCGCTGCGATCGGTGCCATTCCTAGCCAATGGCGGGGACAATG
GTGGGTATGGATTCATAGCTGCAGGAGAGCCATTGGCGAGAGCGCTGCTTGCGCGAGACGACGGTGGGTCGCAATCTCCTCTGTCAATTTAACGATAACT
TGCAGCTGATCATCTGTGGGATTCGGCAGATTACGCTTGTGCCCCTGGGCTGTCTCCTGCTGCGGATCGCGACTGAGCACGGTTGCACGGTCTACACCGG
CAACCTCGCGCTCAATCTCGACCATCAATCGCACCACACGTGGGTATTTATCCTGCATGTCCTTGGGTTTCCTCGGATCAAAAGAGTCCTCCAGCGCGCC
TTGTAGTTGCCAGCGAAGAAGAAGAGCTAGGTGGATAGATCGCGAGCACACCGACAGGATGAGCTCGTCAGCCAGAAAATCTTTTCAAAGTCAAAGTTCG
GAATCGATAGGTACGCGTGCACGATCTGCGGCCAGTAGAATTCCACTTGGTTGATACGCGTGTACGAAAAATGCAACAGCTTCTCCACGATAGGCTTAAA
CAACAGAGGGTCACTGTCCAAATAGCGATGCAGCAGAATCACAGCACGATAGACGCTAAAGCTGCGCACACGGAACTCGCGGTGTAGACCTAAGATTTTC
AGGTCTAGAGGTATCTCTGGATGGTCCATGGTGTGATCATAAAAGCGTCGATCCTTCAGCAAGATCTCTTCACATTCTTCAGCAGTAATTACCTTTGCTT
TGAGCAAGTCAATAGCAATCTTTGCAGACTCAGTCTGCAGCGGACGCTTCGGCATGATGAGCTCAATCGGAGCCTCTGGATTCAACGGACGCGGATACAA
GCAAATACCAGCCTTCAGTCGCTCCATCATCGCACGCAAATAGTTAATGTAATTCTGTGCCTCATAGCAACGGTCACACACTCGCTTGGCGTAGTAGTGC
GACCTCTGCGGGAGCGGCACTTTGTGCGTCGTAAACTTGTCACAAAACAGTCCATCACAACTGTTACATTTGTACAGCAACGCAGCAGCAGTCGGGGCCA
ATTGCCCCGCAGAAGCAGCCTCTGCTACCAACTGCGTGCAGTCCGGACACTTGCACGTCACATCTGTCTCACTCGATGGCACCGTCACGGTGCTCACGGG
CGAGATCGACACATCCAGCGTCGCGTGCTGAAAAAAAGCTGCTGTAAGGCGAGGCACCGTGGTCTCCACTGACGTCTGGATGGCACGGATCCATTTCTCT
TTGTCCATGGCCGTGTCCGCGTAGGCGTAGAAGACCTTATTCTGCGCCGTGGCAAACAGGAAGCCGTGCTGGTAGATGTGCATGTTGCCTTTGCCGTCCC
ACTCCTGCACCCCCAAAACGTCCGCTTCGCCCTTGAGCCGCAGCATGTGATACGCGTCCTCCTGCGTGCTGCTCGCATCACAAACCCAAAGCAATTAGCA
CCAGCAGTCAGACTAGTACCAGAATACAAATCATATACTGTACCTATAGTATTGGAAGGAAGTGCCCACGAGGAAGCAGTAGCGCCGCAGCATGGGCGGG
GGTGACGACGGACTCGTGCGGAAGGTCAGGTAGCCCTCACAGCTGGCGCGCGGGGCCTTCATGGAGCTCCACGAGATCAGACGCGGTCTAATACGACGGC
GGCGTCTCGTGGTGCTGCTGAGTGTTGATGTGCGCTCGCAACGGGGCGCGCAATGCCGATCTGCGCGTGGACTTGGGCGACGGCTGATTACTCACCTCCG
ACGCACCCAATACACACGATCAACGGATCACCGGACAGAGCAGACGGGGGGGGCACGAAGAGTCTGAAGCGGACGGCCACGCGACGCTAGGGACGCGTAT
GGGGAGAGGGAGCGCGGGCCGAGAGCGCGCGAGCCTTCTCTCTTCAAGTGGGCGTTGCGGTGTTGCGTGGGAGGGGGAAGAGCGACCCGCGTTATAGTGG
CGTGTCACAATCATGCGGGAATGGTACCATGAGTATGGTACACTCGGTTTTGCTGGTTGCGAGCCCACCAGCAATTCGTGCATCAACGCATTCGCGACTG
TAGTAGACCGATGGCTCGCGGGAAAAAGACGTTGGCGGCACCGCTGAAGGCGTCCACGCCCAGCGTCAATGGCGGCAGCAAAAGCAGCAAAAAGACGGCC
GGCGTGGCGCAGAAGAAGCAGAGCAAGCAGGTGAAGCCTTCCCCAAAGAGCCCCAAGAAGACGGTGAAGGTGGCGGTGAAGGCGGAGGAAGCAAGCGAGG
GAGAGGAAGAAGACGAAGAGGCCAGCGATACTGAGAACAGCGACGACGCTGATGACGAGGAGGATGACGAGTTCGAGGACCAGGGATCGTCGTCGGACGA
TGACAGCGGCGACGAGGAAGAGGACGACGCGACCTCACGGAGCTGGAAAAGAAGACGCGGCGCTTCACTGTGGACCGCGAAAACGAAGTGCAGAAGATGC
GTGAGGACGGGTCGCTCCAATTGGCATCGCAGTTGCACGTGGACGACCTGTCGTCTGATGACGAGGTGGCTGCCAATGCTTGATGCATGTGTTGCGACGT
GTGAACTTATCCTTTGGTTGTGCTTTTGCAATGATAGGAAAATGTCAACACTATTGGTAACGTGCCACTTCGGTGGTACGAGGATTACGACCACATTGGT
TACAATGTGGACGGCAAGAAGATCATGAAGTCGAACAATGGCGACGGCATTGACAACGCGATTGCCGCGAAGGATGACCCGAACTACGAGTAAGTGACAT
CGAAGCCGTAGGATTCCTCTTACCTGCAGACGTCTGACTGTTGTTTGTCCTTCTTGACAGCCGCACCGTGTACGACGCTTACAACGACCGTAAGATTGTC
ATTTCGGAACGTGACATGGAAATCATTCGTCGTATGCAGGCGGGTGCATTTGCACACCCGGAGTTCGAGGCTTACCCGGACTATGTGGACATTTACTCGT
CGAACAAGATGATCCACTCCATGGGCAACGAAGTTGAACCCAAGAGCCGTTTCTTGCCTTCGAAGTGGGAGCGCATGAAGGTCATGAAGATCATGAAGGG
CATCAAGGAAGGTCGCATCAAAATCGATGAGGAGCCAGAGAAGAAGCCCGATGTATACCAGATGTGGTTCGATGATGACCAGGCGCAGACTCGGAAGGGT
CCTGCTCACGTACAGGCTCCGAAAATGCCGCTGCCCGGACACATTGAGTCGTACAATCCTCCTGATGAGTATCTGTTTACTAAGGAGGAGCGTCGAGCTT
GGGAGGAGGCCGAGCCGGAGGACCGCGAAACTAACTTCATGCCGAAGAAGTTCAAGTCGCTGCGTGAAGTGTGCGGTTACAATGGCTTCGTGCGTGAGCG
CTTTGAGCGTTGTCTGGACCTGTACTTGGCGCCGCGTGTGAACAAGCGTAAGCTTAACATCGACCCCGAGTCGCTTGTGCCGGAACTGCCGAAGCCTCAG
GACTTGCGTCCTTTCCCAAACACACTGGCGCTTGTTTTCAATGGCCACACTGGTCGTATCCGATCGCTGGCTGTGGACCCGTACGGCCAGTACGTGGCCT
CGGGCTCGGACGATTTCACTGTGCGCATCTGGGAGATCGAGACTGCGCGTTGCCTGCAGGTGTACAACGTTGGTGCCGTGGTGCACAAGCTGTCATGGAA
CCCGAACAAAGACCACCAGTTGCTGGCTGTCGCGGCTGCTAAGAAGGTCTTCATTATCGCTACCGGAACGGGTAGCGCGGATCAGACGGAGCTTACCAAT
GCCCTCGTGGGCGACGCCGACGAAAGCATTCAAACGTCCTCCGAGAAGGATGACAAGACAGATAACGCCGATGGCGACGTCCAAGTCGTTGATGAGGATG
AGGCCACCGTAGAGGCTGACGCGCTTAAGAAGAAGGTGCCTGTGACTTGGCTACAGTGGCACGAAGGACAAGCACAAGTCAAAGAAGGCTGCAGAGCGAC
CGTGGCTTGAGCGCCGCGTGGGTACTGGTATTCGTGTGGTGCTGCACCACACGAGCGACGTGAAGGACGTGGCCTGGCACCACAAGGGTGACTACCTCTC
GACGGTTGCCCCTGGCGCCGGCTCCGGAGCGGTGCTAATCCACCAGCTCTCAAAGCGCAAGACTCAGAACCCGTTCCAGAAGAGCGTGGGCCAGGTGCAG
TGCGTGCTGTTCCACCCGTCCAAGCCGTTCTTCTTCCACGCCACCCAGCGCCATGTGCGCGTGTACAACCTTGTGAAGCAGTCGATCGTGAAGAAGCTAT
CCCTCCGGCGTCAAAGTGGATCTCGAGTATGGCCGTGCACCCGAACGGAGACCACCTGCTTGTGGGTAGTTACGACCGGCGGTTGTGCTGGTTCGACCTG
GACCTGTCCTCGAGGCCGTTCAAGACGCTCAAGTACCACGAGAAGGCTGTGCGCGACGTGTCGTTCCACGGCAAGTACCCGCTCATGGCTTCTGCCTCGG
ATGACGGCACCATTCACATCTTCCACGCCATGGTCTATTCGTACGTATTGCTTGGCTCTTGCATTTTCACAAGTGGCTTCTGAGGCGAGCCAGAAGCGAT
TAATTGAGGTGCCTAACTGCTAACTCATGTCGTGGCGTGATCTCTGCAGGGACCTGATGAAGAACCCGCTGATCGTGCCGCTCAAGATCCTGCGTGGCCA
CGAGGTCTCCGGCGGCCTTGGCGTCATGGCGCTGGCCTCCACCCCGTCCTGGTACGTTCCTTCTGCCGCTCAAGCAACGTCACGCCATTACTACCGATCT
AACTCTTGTTGCAATTTGTGTTGATTCGCTCAGCCGTGGGTGGTGACAGGCGGCGCGGACGGTTCCATCCGCCTCTTCCAGAACATTCACTAACTCGCCC
GTTGCAGCGACCGATGAATCCGAGCAACCGTCCACAAGACGTCGGCAGCGGTGCGCTTCTGCAGCTTTCGAAGGAGGAAATGCGCGCTGCCGTCTCGGCG
TGGGCAGCTAGCAACTGTGACGATTTCAACTAATAGACAATGTGCCTTTGAAACCTCAATGCTCGATGCCATAGAGACGACGATCGTTTGTGCCTCCGTT
TTGAGCTGCCGGTAAGCGGTAAGGCTCAGGCGAACAGCAAATTGCGCCAGGCTCATGATGACGGCACACCTCGCCTTTCCTAAGCTGAAAGCCAGTGCAC
TGACGCCGCTGCAATGCTACAGCAGCATGGACACTTTGGTAGCATGACATGTGAAGTCCTTAATTTATTTATCATGTAAAGGAAGAGGAAGAGTACGCGA
CAGTCTCAGTCAAGCTAAGCTACTCGGTCCAAGCGGATGGAACAGTCCTCCCTCCATCTGCACGCATCAGAATACACCACCACGGGGCTCTACTCGCCGG
GAGAAAGAGACCACAATACTTGATCATCGTCGTCCGCCCGCTTGTCCCTTTTCTCGGCGAGGCTGCACGCAACTTCCAGAGAGCCACGCGTCCGTCCTAG
TTCTTCTTGCCCATGCCCGGGATTCGGAACCGTGAGCGCTTAGGAGCTGCTGCAGGCATCGGCGGCGGCATCTGGCCGTATCGCACGGGGTACTGGTACT
GGCCGCCTAGGGTCGTGGCCGGGTATTGCTGCTGCTGTTGGGGCTGACCATACTGCTGCTGTTGTCCATATGCTGCTGCTGGGGCTGACCATACTGCTGC
TGCTGGCCGTACTGCTGCTGAGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGTGGCTGGTTGTTGCCGTAGC
CGTATGTCGGTTGTTGTTGTTGCTGCTGCTGTTGACCGTACGTCGAGTTCTGCGGCGGGTACGTACCCGTGGCCATAACCGGCGGGTAGCCGGCGTTGTT
CATGGGGGGGGCGGTTCTCCTCGTCCGAGTTGCGCTGGTTGGCGTTGGAACCCCCGCGCTTGTTGTTCATGGCGTAGAGCGAGCCCTCTGTGGGCTCTCC
GTCGCCGTCCAGCAGGCTGGCGCCGTCCACTTTGCCCTTGCGGTCCAGCACCGTGTCGCCTGAGAGCACCGCGCGGTCCGACTTCTTCTTGCGCAGGAAT
CCCACCATGGTGAGAATAAGGAGGGCAGGTGGACGGTTGCGTGTGTAGATAGCAGAGCGAGGGGGCCGCTGCTGCTGAGTACCGAGAGCTTCCTTGCGGG
GACCGGGACGATTCAAGTATGGCAACGCGCGTGCGTTTGGCTTCGAGTGACCAGCCGGAAACTGCGCCCCCCTGCCGCTCCTCTTCTATGCTGAAGAGAT
TTGTCGCAATTTTGTGGAAATGCGGCACTGGGCGTTTGTATGGAATTTCACGTCAGCGCGAAAAGGCGCCAGCCCAGAGGCCCACTGCGGCTCACCTAGT
CTCGAACTCCACAGCCAAATCCACGTGGACGCACACGAGCGAGAAAGCTTGCTGACAGATGGCCACCAGACTGGGAGTGACTATGCCGGCCTGTCGTACG
GTTGTGTCGCTCTACAACGAGGGCTAACAAGCCGAGTCTGTGCGTAAACCGCAGCGGCAGACTGCAACTTGTCGTGCAATGGGTTTACGACTCGCAGCAG
GGCATGTACCTGTCCGTCGCTGGGAGAGCTCCGAATTACTGCTACGTGCACTGCAGCTTTCCACGAAAGCAGACCATCTGACAACACACCGTTGCCAGCT
CGCAAGCCGAAAACAGCGGTTTAAGACGAGGGTTTCAGCTGCGGACAGCGGAGACCCACGACGACGACGAGATGGCGAAGCCAAGCCAAGATATTGCATC
CGAGGGTTCGTTCTGTCGGCTGTCGCCGCGCTTAGCTCAACTTGCCTGGGCGTAGCACCGCGTCAACACGGTTGCGTCCGTTTCCACCGCTGCGCTAGCG
AAATTCAAGTTTCAATTTTTAAGTTGCAGTGTCATCGCAGTGGTATCTTACGTATCCAACGCGACTTTTTGAGGCTGAGACATGTGCAACAAAATGGCGA
GTAATTGCAGCGAGACCAAGCACCACAGCCTCGCTGGCAGCAAGTTGCTGCTCGCTACGCTCGGCCTAGTCGTCGTCGCCTGCTATGACCAAAGAGCTTC
ACGTCCCGGGACGTCTGTGGTTCACGACGCTCAGCCCAGTCGATGATGCTTGACCGATCACATCCTTCAGACGCGGACTCGCTGTCTGTCTGTACGTCAC
CGCAATGACCGCCCGAGGACAACTTCAACCACACAGCCTCACAACGACGGCAGCCAGCCCGTGCAGCCACTTTTCGATCGCCCGCATTGAGTCGAGGCTC
GACATCCCAGAAGAGCTCTCTCGCCGAGTGCGTGGCCTGAATGAGTCTCTACACCAGCACGTAACCAGACCAGCCAGCACCAACGTTGGCTTCGTACTAC
CTCCACGTGTCCAACGTGCGACCGAGCGTTGCATCGAGCAGCTGTGCGGCCTGGGCAACGGGCTGCACAATGGCCTGCATTGACGGTGTGCCTGGACTTG
CACGGCAAGATGCAGTGAATCTGGCCCTGCGGCATTTCTATCAACAGAAGGAACAGCAAAGTCCGCGAGGGTTGGACGTAAGTCAACAACCAAGTTCTTC
ACTCATTACCGGTCCTGTAACGAGTTGATATCAACACACTTGGTAAGAGCATTAGTGTATTAGCACGCTACACGACCATCTCAGTCAGGTTGGCGTGGTG
ACTGTTTGTGAGGGTGTCTCTGTGTAATGGTGGTTCCAGTGGCGACCGGGAATCTGTACTGCTATGCTGCGGGTTAGTGTCTTCACCACGTCACGTGTTT
GTCGAGGAAATCCCGTGTCATCTCCTCGTTCTGCGCTATGTTCTCCATAGTAGGTATCATAGGACATGTGCCACGGATCCGGCACGTCTCGCGTGAAGAC
GGCGAGCACGCTATCTCGCTCTGTGATCTTCGGGAACTTCTCCGTGACCTTGAAGGCCATCCCGCTCGCCACGCACACCACGTAGTCGGCGTTCATGCAC
ATTTCCTCTGTCAGCAGCCGCGAGCGGTGAGCCGACAGGTCCAACTCGTACTTCTTCATCACGTCCACCGCGAACTTGGACGCGGGCGAGCCCTCGCGGT
CGAACACGTCCGTTAAACTGCACGGCGAAAACAACCATCAGCAATTTCGGCAGCCTCCGCAAGTTCCTAACAGCGAGGTTCGCACGTACGCTGCCGACCG
GATGACAATGCCCTTCTCTTCCTGCTGCTCGCGCGACATGTTGAGCTTGCGCCGGAAGTACTCGACAGCGAAGAGCTCCGACACTGGCGAGCGACACGTG
TTGCTTGTGCACACGAACACGATGTTCATGGTCTCTTGGCGTGTGCGGTGCGGACACAATTCTGATGTGGAGAGCTTGCTGCGACCCGCCGCCCAATGGT
TACAAAGACTCCACAGCCAGCAGTAAACGAACGGGGCTGGAGGTGACAATTTCGTTCCCGCTCGCCTTGTTGGCGTCGCCGACTTCAAGCGCGATGGCCG
TCGCATGCGTGCGGAGTGGATTTGCAGCAGATTTCCAGGCGACCGCCTGAAAGCTTTCGACCGGCATGAGCGACAAGCAATATATCTACATGCACGAGCA
AATGCACACGAATATGCACAATTTGGTGGCGAATTTGCCACACGGGAACTATATTTGAAATGCCACGAATGTGCTTCCAACGTATCCAATGCAACCGCAG
CTAGTTTACTGGAAGCGCTGAACGACCTTCGCGTACGGGAATGGTCCCAAAAACTCGCTGTGGTTTTGCTTCTTGGTAGACGCCTTGAGCAACGAATAGT
CGAGTTCCGTGTGCAAGTCTTTGTTGGCAGCGTACGACTGTGGATCCCACTGGATGTCGAAGCTGTTGACGAAGAAGCCCTGGAATTGTGCGATCCATTG
ACGCAACGCCATGTACGGGATGAAGTAGAAGCCGCACCGGTCAGTGTCGTTCTCCTTCACCTCCTCATCAACGGGTGCCAGAGTAAGCGCGATGTAGACC
TCTAGCATTGGAGGCAGGCACATCTCGCGTGCCACATGCTGCTCTGCCGAGTACTCCCACAGGCACATGACAGTCATGCGGTCGCCCCAGTCCGTCGTGT
TGCGAACGAAGTAGGTGAAGTCGCTATCCGTACGACATAGCTCTGAGTCCTTGCACTTCAGATGTAGTGGCTGAATATTGACGTCTGCGAACACTTTTGT
CTCGTCCGAGAGGCAGTCTTCGATACCTTCATTATACTCCAGGGTGTTGTTCGCTTGCTGCTTGAACGAAATGCCTTCATTGCCGCACTGGTACCAGTTG
AACGGGCTAGATAAATGTACCAAACAGAAACAGTTAGTTAGTCATTTTACAGAGTAACCATGCTTCGCAACGTACTTGTAGCTGTTGGGGCAAACCGAAC
GCTCTTCCCAATCCGAAACCTCCTGCATCCAGTATGCGAGAGAGTGACTGCCTTGATAGGGCCCATCCGCCCAGGAGTTCTTCACGATAAGTCCGCCAGT
GAAGCCTTCGCGAGTAAGGAAGGCGTCATTGTAGCCTACAAGAAGCTGCCAACACAATTGCAAAAAATACCGGGTAAATGACGTAGTCGTCACACAAATC
TGACAAATAACTTACCATGGCGTGACCACCCTCGATTGACATGCCACGGTGGCTAAAGAATTCGCCTTCCATGTTGCGGTTTCGACCTCCCTTCAAAGGA
ATGCAGCACGTCGTAGTAGCCATATCTCCTGGACACAGCGTACACGTTTCCGGCTGGCAGTGGCGATCATTCGAGAACGCGCCAATGCACGGGTAATAGT
GAGTGACCATGGCGATCGGAGTGGAGAGAGGCATTGCTTGATTTTTGCGGACAAGGTGCTCCCTCACGGACATGTCTTCATACTTGGTCGTCATGCTCTA
CAATATCGAAATCGAAACAAAACACAGTGTTAGCCAACCTAATTTCCGATGTGATTCTTGACCGAGTCTCTTCGCTTACAGAAAGCTCGAACTTGAGCGG
ATTCCCAGCCGTTTGGGCGGCCTGGAGACCTGGACAAAGCATGTCGTTGCCGTCTTCGGCGTAGTATTCGCAGACAGATTGCGGGAATACAGACTCTTTG
AGACCATTTTGTAGGTAATAAAGTTCCGGTACCTCTCCCCCTCTGTCGAGTTCATCCACATCTGTATATAGCAACGTCAGCATTTGACAATAGTTCCAAA
CAATAGAATATGGCTGACCTCGTCACCCGCCACTCGGCAATCCTTTTGCTGCTGTGAGTCTGCATCACCGGTGCAAAGCTGGAGGATCTCCACGCCGTAC
GCCTGCAAATAACCACATCGATAATAAACACCGATGTTCTGCAACAACTTCACTCAAGGATATTAGTCCAACGTACCTGCTCAGAAAATGCAACATACTC
ATTAGGTTTGAGCCAGCCTTTGCGGACACCGTGTGCGCGATACGACTGCTCTAGGAACCCGATCGTCGCAAAGTCCCAGCACGTGCCACGATAAGCCTGA
TCCTGGCGCGGAGTCACGAAGTCCACCGCGAACTTGGATGGCAGCAACGCCATCGGGATCAAACCATTTTTGGAGACGAAGCTCATGGCCACCGGGTCGA
AGTCCTCATGAGCAGCATTCGGCGCATCTTGGCGGGCTTCGCTGGCAGTCTCCCTGCAACAGCATTAGGTCAGTAATGATAACAGCCAAACGTTAACAAC
TCTTCAGATCTTTGCAAGGCACATACCGGTACACGCTGCTGCCAGCCTGAGTTTCCAGACGCGAAATCGTGTTGTTCATTGAGATACATAGGAACAGGAG
CACGAAAAGCGCGACGCCGTTCACCGCATAGAAGACCGTCCGCAAAGGAAGGCGGGGCAGTGCACCGCGCTTATCAGCAACAGTGAGCTGTTGCGAGTGG
ACGGGCAATTCATCTCTGTCGTTGTTAGCTGGGTACAAGCACCATAACGCATTCGCAGACATCGTTAGCGTGCGATAAACAAACTCGCCTCTGGGCTCTA
ATCGTACCTCTCCCGGAGCCGTAGCGTAGCAGAGGACTGCGGTCTCTAGCGGAGACCGACCTCACCATTCGTCGTGCGGTGTAGGAGACGCGTTGAAGAA
TGACGTCTAGCAGCCGATCGGATTTCTGATCGGCAAGTACATCCGAAATATGCTTACCGTGTGCAAACGGACCAGCGAAGGACGCCATTTCTATCCAATC
ATATTCCATATTTTTCAAATTAGAAACGTTTGATTGGTTGTTTATGAGGTGCCCGTAAATGGCGAACGTCCGTTCATACACAAGGTTCACGGTATTTGTA
TCAAAAATGACTTCACTTCACTAAAGGAGAGCTGTCTGCAAAACGAGACCTGTAGCTCAAGTTGACCGTCGTGACTGTGAGAATGCTATACCTATAGATA
TTAACATAGTTTTTCCTTCAAAACTGTCATCGCAGACTACTGTGCATCTACTCTTTGCAGCCATCGCCACCGGCGATCACGAGACACGCGGTAGAATCGA
AAATGCTCATGAGGTTGGTCATGACGGACCAAATGAGCGAGAGCGACAGATACGCCACCGTGACAAACCCCATGAAGTAGCTAGAGCCTCCCAGACGCTT
CATCATTTGGGTTTGTTCCTTCTGTCGGGGAAGCATCACCAGGAACGCGAGCGAGAACAAGTTGGCCGCCCACATGATAAGTACCGTAATGGTAACGTCG
TGCCTTACTCCTTGGGAGTCGTTCTGGATCCGCTCCGTTGTCAGGTCGAATTGACCATTGACATTGCGGGTGATCGCAGTTGCAAAAGGCGTCGAGAGGT
TGTAGACCGTCGTGAGCAGACCATACATGGCACCTTCGTGCCCTTCCGTGGACAGCTCGACGATGATGAAGGAGCCCACGATGAAGATGATACCTTGTGG
AATTTGCTCAAGAATGGGAATTCCCATCCAGATCCATGGCGAACGGACGACATCCCAGATTGTCAGGCTTGCCCACAGCATCCAGGCTCACGTTGCAAAT
CATAGTCACGACCGCCGTACGCCGCCAGTCCCAGTCGCGACCGTAGTTGCCGGCAAACCAGACTGCGATGGCAAACACGCCCGTGTTGATGAAGCCGGCG
ATTTTATCTTCGAGCGGCGAAACGTTAGCCCAGGTGGTCTGGATCGGATAACCCGATACGTACGTGAATGACGAGAAAATACCCGAGAAGAACTGGTAGG
CAATGTACTGGTACACGGCCCGTGTCTGTACAACGTCCCAGAGTTCGCACATGTAGTGCTTGAAGCTCTTGCTATCACCCGGGCGCTTCTCTTCGTAAAT
AAACATCCACGTGATCGGCACAATCGGCACAAGAGCGACTGCCACGATCAACATCATGATTGGGAACGTGAGCGAGAAGTTAAAATCGCCACCGTAGTCC
TCGCCGTTGAAGCAAAATGCTACCAGAATGAGAGCGAGGTTGTTGAACACAAAGCGTGTGGTGTAGATCACAGTTTGGGTTCTTCCTCGAATTTCGAGCG
GCTCGCGCTGCGCCAACTCCACCACAATGCCGTCGGCGCACACATCGGCCATCAGATACCCGAACGCGCAGCCCATCATTGGTATAACGTAGACGCTGCC
ATCGTCGGCTGCGCCGTAGTTGAGCGTGGCAATGATCTCGGGCGTGTAGTCCTCGGGCTTTATGTCTCGGTACGCTGGGTCGGTGAAGTACGGCTCGCCC
TGGGGTGTGAGCACCATGACCAAAAGCATGGCTAGAGTGATGATCCAGCCGATGACCATGTACGGTCTACGGCGATAGCCATGGATCGGGAAGCAGTCAG
ACACGATGCCGTAGAAGACCTTGAAACTCCAGGGCAGCTGCACAAGCACAGAGGCTGTAGTGGTTTGGGAACCGGGGAGGTTGAGGTAGTTCTGCAGGAA
GGGGTAGATGACGTTGGGCAGCACTCCGTCAATTAATCCAACGGCCGCGTACTGCGCGACAAGGCCGATATACTGCCTCGAAAAAAGTTTTGGTGCGCCA
CCGCTCCGGAGCGCGCCGCCTTCGATGTAGTCGTCGTACACGTAGCGCATTTTCCCGTAATGATGCGCGGGTTCCAGCGGCGACATGCTGCATTGCGAGT
CTCCCAGCATCGCGGCCGCGTCAGGGTTGTACAGCTCAATCTGTTCCGGTAGTGGCATTTCGGTCTTCGTAGGCCTGAAATCAGACAGGCTCATGTGCTG
AAGGCTGCGAATCGAAAACTACTGAGCGAGGGGATCTGCTTGCAGGGCAGATAGCATGGATAATCGCAAGTGGTGGACTCACCTCCAGGCAGATGCAGAG
GTCGGGCCGACTTTTCCGCAGGATGTGCAGTGTTAGTGGTTCACCTCGCCATATTGGCCGCCATACTGGTTTGGCATCATCGAAACTTTCTCATGAACAG
AGGACAAAACAGAGGGCACCGAACACACGCAAGAAATGCAAATTCGGTAGGCGACACTATCGATTGCCGCTGTTGTAACGGCGTTATTGCATGGACAGTA
AGGCTTATTTAGCTACACCTACGCTGCGAAAGAAGGTTCGAGCGGACGAGCAGTGAGATTCCGAGTCGGAGTGCACATGGTAATTCGGCAAGGGCGTACG
TATCCTAGACTCATGCCTGGTTGTAATTTGCTGGTTTGCTGGCTTGATGTAGTACGGTACCGGTGCTGGTATTCATACAGCAAACCACCAAACGACAACA
CCGGTGCAGCAAACCATTTGGTCAATCTGTCAACTGAGCTGCTCTCTGCAACTGGAGAGAGCACCTTCAGCTGGCAGGGGGTGCTGACCGTGACCGACCA
TAGGGTCCTCGCTAAGCACTACTGACGTACTTGCACATGCATCATACATGATCTACAGTACACGTAGGGGGTTGCACACATCTTGAGCTACCATACCTGG
CCTACGGGCTGGAGAAGTCCTGAGGACGACCACTCCAACGGGTGGTCCCATTCCGCCCCACACGGTACTTCAGCCATGGACCGGTACAAGCTGGCAAGAA
GTCATCGACGACTCGCGTACGAGTTGTTGAGGAAGGCCGCGCACAGTACTCGGTGCGAAGAAAAAAGTTTACCGTTCATGCGGTTGTAGACCACCCAGCA
GACGCAGGAGCACATGGCACGCATGGTAAAACGTGAAGCAGGCTTTTCGATGCCATGACTTGTTGTCGACTGTATTCAACAGAGACCTGGCATTGAGAAT
GGCATCGGACGACGCGAACTGGCTTGGCCGGCTCGAGGCAAACGCCAGAGCTTCGTTTCTTGAGCGGTCGGGCTACGGGATACCTTCACGATTTGAAAAG
CCCGCCAATGTTGCACTGAACTGCTGGATGTACCAAACAGAGAGCCCGTCCGAGTCAAAGTCTCTGCTCGAGACTGTGAGAGAGGAACTCTGCCAAGGCA
GCTGGCAGCCGTCGTCAGTCTCGAGGCTTCCTGCTCGATTTGTAGTTTCCCTGCGCGTTCAAGGTGGTACCCACCAAAGAAGGACGAAAACTGGTGGAGG
TGTCGTGCCGCGAAGCGAAAACCAGGGCTTGCTCGTTTCCTGTGAGCTTAGATATTGGACGAGAGGCTATCCAGGCCCCGCGTTGGACTGCGAGGCGTGT
GTACACTGTAAAAAATCCGATCTTACCGCATTAGTCAAATTGCGTGGCGAGAGGCACTCTACGACTGGTCTTGGTGGGTCTTGCGGGTCAACGGACAGGT
ACCACCGTCATGAAGGCATCGCGGACTGACACGGTGACATCGCAGCAGGCACCAATCGAGCTGTACAACGAGGACTCGTGCTCGTGGATGATCACCGATT
CTCCGGACGATGGTTCGCCGTTCCCGATGACGTTCGAGGGCCAAAAGATCCGCTACATCTACGACGACTACATCGAAGGCGGCGCGCTCCGGAGCGGAGA
CGCTCCGAATCTGTTCTCGAAGAAGTACATCGGCCTTGTCGCACAGTACGCCGGCGTCGGATTTATTGACGGAGTGCTGCCCAACGTCATCTACCCCTTC
CTGCAGAACTACCTCAACCTCCCCGGCTCCCAAACTACCACAGCGTTCGTCCTCGTACAGATGCCCTGGAGTTTCAAGGTCTTCTACGGCATCGTGTCTG
ACTGCTTCCCGATTCGTGGTTACCGTCGTCGACCCTATATTCTCGGCGGTTGGGTCTTCGCGTTGACCATGCTTGTGATACTGGCGCTCACACCTCAGGG
TGAGCGTACTTCACAGACCCAGCGTACCGAGACGTAAAGCCCGAGGACTACACGCCCGAGATCATCGCCACGATCAACTACGACGCAACCAACGACGGCA
GTGTCTACGTTATCCCAATGATGGGCTGCGCGTTCGGGTACTTGCTATCGGACGTGTGCGCCGATGGCATTGTGGTGGAGTTGGCACAGCGAGAACCTCT
TCAAGTGCGAGGCAAGACGCAGACGGTGATCTACACGACGCGGACAGTGTTCAACATGTTGGCATATATCCTTTTGGGCTTTTGCTTCAATGGTGCGGAA
TACGGCGGAGACTTTGACTTCTCACTGTCGTTCCCGATGCTGATGTTGATCGTGCTGATTGTGCTTTCGCCGATTGTGCCAGTCACCTGGTTCTTCCTTC
ATGAGGAGAAGAACGCTTTCGGGGCTATGAACTTCAGTCACTACATGCACACCCTTTGGGATGTCATCAAGACACGAGCCGTGTACCAGTACATCGCTTA
CCAGTTCTTCTCGGGCATTTTTGCTTCGTTTACTTACCTTTCCAAGAACCCGATCCAGAGGAACTGGGCGAACGTCTCGCCGATCGCCGAAAAAGTTGGA
GGGCTGTTGTCAACGAGCGTGTACGCCACGTCGATTTGGTTCGCTGGCAACTACGGACGCAACTGGGACTGGCGACGAACGGCAGCGGTGACCATGATCA
CGTACGTGTCGCTGGATGCCTTTTGCAAGCTGCTGACGATCTGGAATGTCATCCGCTCGCCGTTTTTCTGGCTTGGTATCCCCATTCTGGAGCAGATTCC
GCTGGGTGTGATTTTTATTGTGAGCTCCTTCATCATCGTGGAGCTTGCTACTGAGGGACACGAAGGCGCCATGTACGGCCTCCTCACGACGGTCTATAAC
CTCGCCATCCCGTTCGCCACCGCTATTACGCGCAACGTGGATAGTCTGTTTGACATTACCACGGAGCGAATCCAGAACGACAGCAACGAAATCCGAACTG
ACATGGCCATGACGGTGGTCATCATGTGGGCAGCCAACTTGTGTTCGCTCGGTTTTCTGGTGATGCTGCCCCGCAAAAGGAGCAGACACGGGCCATGAAG
CAACTGGGCGGCTCGAGTTACTTCATGGGCGTCGTCACGGTGTCGTATTTGATGTTCGCGTTGCTGTGGACGTGTTCGACGAGTCTGCTGAGCATCTTCG
ATTCCACTGCGTGTCTTGTCATCGCTGGTGGCAACGGTTGCAACAAGCCAAAGAGTCCGTAAGAAGTCAAATAAGTCTATCTAAAATGAAAACTGCAGCG
CTAACCGCTGCCAATTGAGTCTCTTCACCCTCTCCACTCGAACATCTCTCATCTAGCACAAAAGCACAGCATACTGTAGCAGTAGCGCTCATTCTCCAAG
AAAGTCTACACCATCTCCAACACAGCCAACTCGACAAATGCCACGTCCTCTTCACTGAAAAAGCGACCAGTCCTTGACCGCGAAGGACTGCAGCGCCTGC
TTAAATATGGCGGCGGCCACCTCCGAGTTGTCCTCGAACTGAAAGGCGTCGCGGCTGCTGCTGGCCGGGTTGATGCGCATGGGTGCCGACATCGACAGCA
CCACGTCCGTGGTCACGCCAGGCAGCCGCACGTTGCCCAGGTACACGCGCACCACGTTCTTGGCGTGGTCGCCCTCCTTGAACTTGGCCACGCGCTGGTC
GCCCACGATGAGCTGCGTGGTATGCGGCGCATCGACGGCGGGCGCGTTCCGAGCGTCGGCCGCCGCCTCCAGCAGTACCGTCACCTCGTCGGGGCCGCAG
CCGTTGGACTGCGCCAGCTCGTTGAAGAAATAGCGCGCGCTGCGTGCGTCCGAGACGCTCTCCTCGTACTGCAGTAGCTCCACAATGACGCACTGGTCCG
TGGCCGCGTTGGCGAAGACCTCCTGGTTGTCTGGAACCTGCCGGAACGAGCTCACGTCCGCGAAGCCCTCGGGGATCTCGCAGATCAGCGCGCCGCCGAA
CAACGGACGCAGCATCTTGACTTGGGTTGACACTTGACTGAGGGGTTGATGTGGAAGTGAGCTCTTGGGTTGACACTTGCCTGAGGAAAGTGACTATTGG
GTACCGTCACATATTTGGTATACACCAGTGGCCTGCGGCATCCAGCTATACTGTGTATAGGTGTGTCCGATTAAGTATCCACGATTCGGATGGGTCGCGG
CCATTAGATCGGAAATCAACCAGCAGCAGCAGCATGAAGATCGAGGAAGTGCAATCCACGGCCAAGGCGCAGCGCATCGCGTCGCACACGCACGTCAAAG
GTCTTGGTCTCGAGTCGGACGGCTCGGCGCTGCCCATTGGCTCGGGCCTCGTGGGTCAGGAGAAGGCGCGCGAGGCCGCGGGACTCGTTGTGGAGCTCAT
CAAGTCCAAGAAAATGGCGGGGCGCGCTTTGCTTTTCGCGGGTGCGCCTGGCACGGGTAAGACGGCCATGGCTCTGGGTATCTCCCAAGAGTTGGGGCCT
AAGGTGCCGTTCTGCCCTATGGTGGGCTCGGAGGTGTACTCGTCCGAGGTCAAGAAAACGGAGATCCTGATGGAGAACTTCCGGCGAGCCATCGGCCTCC
GCATTAAGGAGAGCAAGGAAGTGTACGAGGGAGAAGTGACGGAGATGACTCCAGAGGAGACGGAGAATCCCCTCGGCGGCTACGGGAAGACCATCTCCCA
CGTCATTGTGGGCTTGAAGACCACGAAAGGCTCCAAGCAGCTGAGACTCGATCCCAGCATCTACGAGTCGCTGCAGAAGGAGAAGGTCTCGGTGGGTGAC
GTCATCTACATTGAGGCGAACAACGGCAGCGTCAAGCGCGTGGGGCGCTCGGACGCCTATGCGACTGAGTACGACCTTGAGGCAGAGGAGTACGTGCCCA
TTCCCAAGGGCGACGTGCACAAGAAGAAGGAGCTGGTACAGGACGTGACGCTCCACGATCTGGATATCGCCAACGTCCGCAAGGAGGACAGGATATAATG
TCCATGATGGGCCAGATGATGAAGCCCAAGAAGACGGAGATCACGGAGAAGCTGCGCACGGAGATCAACAAGGTCGTGAACAGATACATTGACCAAGGTG
TGGCAGAGCTTGTTCCCGGTGTGCTGTTCGTGGATGAGGTGCGTGATGCAGGTGGTCTTGTTTTGGAAGAGTGATGAACTAACTTTACATTTTTGTGCTG
CTGTAGGTCCACATGTTGGATATTGAGTGCTTCACTTCCTGAACCGCGCGCTGGAGTCGACGCTGGCTCCGATCGTGATCTTCGCCACCAACCGCGGTGT
CTGCCAGATCCGCGGCACCGACGTTTCGTCTCCGCACGGCGTGCCGCTCGACCTGCTCGATCGCATGCTCATCATCCGCACGATGCCCTACTCCGTGGAG
GAAATGGTTCAAATTCTCAAGATCCGCGCTGAGGCAGAAAGCATCAAGCTCTTGGACGACGCCACGGTGCGTCTGGGCGAGATCGGTTCACAGACGTCGT
TGCGATACAGTGCTCAGCTGCTGACCCCGTCCCGGATCCTCGCAGAGACTCAAGGCCGCTCCGACGTGTCGGTGGACGACATCGAGGAGACCAACGACCT
GTTTAGCGACGCCAAGCGCTCGGCGCATGCACTCGCGCAGACGGAAGGATACCTTATGTAACGACAGACAAAGATACCTGCATCAAAGCGTCTGTCCGCC
AAATACAATTGAAGGGTCACTCGCTCATTGACCTCTTGACTCGTGCTCTCCTCCTGTTTCGCTAGATGCAATGGAATCCATGAACAGTGAAGTTGTGCGG
GAGTCTGCAATCTTCGCAGCACTGTCTCCACGAGGGTACTCACGACGTGAACGCCCGCCGGGGAACACGGACCTTCGAGGCGCTTCGCCAGCAGATGGTG
GGGCTGTACCGAGTGGGTCGCTCCCACCGGTGACTCCACGTGATGTAAACGCCATTCTCCGAGCCCCACCGCAACAAAGCATGAAGATGTCGCCAAAGAC
ACCTCAATCGCTGATGCTGTCGGTTCCCATGACAACAAGCGAGTGCTGGCTCGTGTGGAAATTCTTGTGCGATTGGGTAAAAACGCAGGTAAACATTTAC
GAGTGCAGCAACTCGAAGATATTATGATCGGACTACATGTATAATAATTGTTTGTGTGGCGATATGTCATAGCTCGCGATGGAAGTTCCTGCTTCGATCC
CTGGTTTCGGGACGTTTTACCTACGGGTCCAGTCTTTAGGCATTCGTATCACGCTTTTTGGTAAGTGAAAACTCGAGCATGAGACTAGTACCCAGGTTTT
GTGCAGTTGTAACTTTTTTCCGGCTTCGTAGAACCTGACAAGCAATTCCTCAACAAGTTTGGGCTTCTAATGGATTCGGAGATTCCTGACCCAGCACTTG
TTGCCGTGCTGCCCCCAACGATGTCTAATTCCGACACATTGGCATCTACCGGTAGCCGTGGCCGAGCAGCCAGTGTTATCGGGCTCGGCAATGTCTTTGC
ATTTAGTTTCGTGGAAATGGCTGCATGCTGTGGGGACGCAGTCGATGCGAAAAGAGCTCAGGAATGGCTCACCGTGGTCATCCACAAACTGGGAAATGCT
TTGAGTCAATGTGGCCGAGTATGTGCAAGCCCACATATTTGCTGGTTGCTTCTATCGCTAACATTTACCGCTACTTGCAATAGGTAGAACTAAATATCGG
TGTCGGGGTAATCGTGTGTTCTGATCGTATCATTCGACGGCATCTACGCTCACACGATTCGGTATACGCACTATGCTATCAAGGCTAGATACATGATGGG
AAAAGTTTGGCTAATGAGGTTTGTTTATGCCTACCGCGTAGCGTGCTTCTCCACGACTGGAGTATGAAATTCGAACAGGAGAAAGTGTTGTCAAACGAAA
CTTGCGGGCTCAAGCCGCTCTTCAAACCGTCCATACACCAACTAAGAACAGGCATGTCAAGGTTTACGATCGGTACTTTGTTGCAGCCAAACTAATTATT
GCATGTGGTCTCTGTGTGCATGCTTGCAGGTTCTCTTTTTTATCGGGGTCCACCTTTTCTTCATCGATCCAGCTAAACCCTGTGGTAGACCGATCCAAAG
ACGTTCCAGACTTCTCGTTTGGGCCGCCAAACCCGCGACCACCGACATTTACTTCTGTGGGAGTTACTTCCGACAGTAGGTCGACTCCACTTTCGACTCA
ACTAAAAAAGCGATATCAGCGATCACCCAGCCCGCTAATCAATCGTATCAGTACTCATGTGACCGCACCGCAACCACCAGCTTATGAAGGGCAAGCAGCA
AATAGTACACCGCCAATGCAGAAGCAAACAGAAGAGATTTGGATGCCGCCGCAGCTATTTGATGGACTTAGTCGGACACTCTGTGTGGAACCTGATCAGA
ATGTGTCGTTCTTACTTCCCTCGAATCGTATTGGGTCGAACTTCACGGAGTCTGCAGTGTTTCTGATGACAGAGAAATCCGCGTCTCAATTCGGTCAGCA
AACTCAGCACGTCGGGGGGTTGGTATTCATCGACAATCCGAGCTTCACTAATCTTCAGCTGCGACGCAAAAAGAAAGAGTCGACTGACAAGTCAATATCT
GAACAACGATACTTCGAGTATTTGTCCGATGACAAACTAATTGATCCCCGCTTCCTTGCGCCGCTTTCTTCTGAGCTCGAGACAAGAGTTGTGACCGCCG
CTGTGAAGTATATTGTGGGACCATCGAGTAATCATATCGAAAAGGTGATGGAAACAGCGCATGGTGAATTTACAGACAATTTCTACTCAAGCGCCAAGAA
AGCGATTCTAAACTACCTCTTGATGCGGGCAACATCCTGTGAGCGGCTTGGAATTCCACACGGAGTACCAATTCACGCCGTCCTCCCAACAAAGTGGAAA
TGGGGCAGTAGCGATGGACCCAATGGCTGTCTTTCAGACTTAAAGGCTTTGGTTTTAAAACATGGGGGCCGACTCACAAACTCCAAGCGCCAAAGGAACA
CCTATGCGATCCAGCAAACATTAAACACGGAGCGTTCTCGTTACTCGGAGGCAATTCATAATAAGGCCGTGCGTCGTAAGCGTGTACAGTCAAAATTGAT
GTCGCTATTGGTTTTGTCGAACCCCCAGGTTCGGGCTCTACGTTTCATGTGGTATGACTTGCACACATCAGCCACATTGGTTGATCTCCCAAGCATTGAA
GGGCTCAGCGATGTCATCGAACCCATGGATATCATTAAGTTTGAACGAGCTCAGCTCGCTTTTTCTGCGAAAATGAAAACCTTTGTCATGGAAAATTGGT
ACGTGAAAACTAAAATGATGTTCGAAAGTGCCGTCCGAGCCGAAACCTTTTCGATACACACATCAGAGGCAGCAGTGAACTTTCGCCTGTGCCACCTTTT
CGACACCGTAGCGGCAGTAATGTCTCTCCAGCTCCGCTCGCTTATTATGAAGTCAATCCAAGCTTACGTCAAGTTTTTCGAGCTGTTTGGGACGATAAAT
GAAGATGAACAGGAAAGCGGCAGTCTACGAGCCCAGGGTCGGTCAGCGCTCTCTGGTTTGCAAACAACGCTGGTCTTGAATGATGGGCAAATACAAGTAA
GTACCGCTTTCATTTAGCAATTATCTTTGCCACGCTAGCTGATGCGTATGATTTCTACTTACAGTTTCGAGACCCTCTCGTCGACATTCCAAGTCGCCTG
TTGAACGTTCTTCACAACATACCCAAAATGTTTTACAACCTCGGACGCATCGAAACACAATTTGAGGAACCACTTGTGCTGTCCAACACTTCTTCACCAT
TTCTGTGGAACGTAGCTTCACAGGAGGACGACATCGTCGTTGCCACGATTCGAATTCGATCGATCATTGAGCACAACCTAACGTTTTTGCGAAAGCTGCA
AAGCGAATACGACGTGTTCGCCCTGACACACCGTTACGTGAATTCTGTTGACTGTTTTCACCTGGAGGAAAACGGAGAACTAGAAACCTACCGGGCTGAG
ATGGAACGCGTGCAGGCAACCACTATGCAGCTCGCGATCGACAATAGACATTCACAAAATCTTGGTCTTTTTTCAGTCGATTGCCGCCTCGTGAACACCA
AGTTACACACCGAACTTGCCCAGTGGACTATTCGACTGTTTCAAGCGTTTGAGCAGCGGACAGGTAGAATGAATGCTGAGCTTCGGCAGCAGTACAAGGA
AATTGCAGCTCGATTGGCAAAGAAACCATTGGATTTGTACGAACTCGTCGATGCCGAGACATTTGTGCAGTCGCTAAAAGCAGCTAAGCTACAAGAACTT
CAAGACCGGGGTAACTCTATCAAGCAGCGCCTTCGGTTCTTGCTATTTGAGCGAGAAAATATGCACATTGGTAATCTTGCAATTGACTGGCCTCCAGATG
CACCGCCAAACGATGAAAGTGACGCTTCATCCGTACAGGTGGCAGGTTTCCGTCTCTCGGTTGATCTCCTCTCTTCGACAGCGAAGACTGTCAAATGGCG
TAGTCATATTGAGAAGTTGCTGAAAGAAGCCGAATCGCTGCTTGTAAACGAACGTGCACGAATTGAGGCCATGTTTATTGCGAAAAGGTCTCGATTTCAG
GCTGAAATTGAGGAGTTTGAGAGCGAGGTTAGAGGGTTTGCAAAGAAAGGAGATCTACGACATGCCGCTACGTATGTTGTTCAGCTTGCAAAAATGAAGG
ACAACATGTTTATTTTCCGGCAGGCGATGGAGACTATCGTAAAGGAAGAGCGAAAGCTACAGTGGAAGCCAACGGATTTCGGCAAACTCGATGATATAGC
AGAGGAGATGGCACCATATGAGCAGCTGTGGAAGACCGTAAGAGAATTTCGCGAGATGAACTCGCGGTGGTTACGTGGGAATGTATTCGAGCTACCAGGA
AAGGAAGGAGTCCAAACTCTGCAGCAAATGCTCACTGTCGTTGCCAACGTGTCAAGCGTGCTCCTTTTGAACTCAGCCGCGGCGGCAATCACTGCAGAAA
CAGTTCGAAAGCAAATGACAGACTTTCGTGAGAACGTTCGGCTAATAATTGCCATTCAAAATCC