Description :
From Genome Similarity Track
Location :
Scaffold_913:6460- 8294
Sequence
1834 bases(100 bases per row)
TGTTGAAAGGTATGCATTCTAGCATAATTTGTTGAGAGGAAGGACAAGCTTCTGCGTGGCCTTGAGCCGAAGTTGTAATCACCGACATAATTCTATGGAT
GCGTCTGCAGCCCATCGCCTCCAGTTCACTTGCAAGTAAATCACATAGAGAAGGCTGCAGTAGTTCAGGTGTAGCAATAGATTCCACCTCCATGTGTTGC
TGCTGCAGAAATCGATTCTTCATTTGTCGGCTGGCTAGCGCCTCATTCATTAAGTTTGTCATTGACTCGAGAAATACAGGAACGAGCGAGCGATTTATTT
CGAAGGGAGCCAAAGTCAGCAACCCGTCGCGAAAGGTTTGGTTCCTTTCACGCATTGGCGATGCACTAACGCTCAGTGATGCAGGCGTTGCAAAAAACAG
CTCTCCATGAAGAGGAATGACATCAAAATGGCTTATCTCAAAGATCATCCGGTTTATCAGACCCAAGTACGGATTCAAGGCGCCAATAAATAGGTGTAGC
AGAACATCGGATCGTGGCAAGTTATCTGCAATACTTGAATCGGCTGACAGCCCCTCCACGTACTCTAACTCCATCATGCGGTACAGCGCATCGAGCACAC
ATTTTGCCCGCTCAGCGCGCTTTACTCCATGCCAATGCCGCTCCGATAAACCCTGGAAGCATTCTATCAGAACTCTCTTCAACCATGAAATCATCAGAAA
AATCTCCTTCAGGCCACCATAGATACCCAGCAATGTAGGCTGTCGCGACGCAATGCCAGACCACGGACTTGGGTCCTCGTCTTCAAGGTTGACTGCAGTG
TTGACTTGCAGCTCCACCTTGCGTATCGAGTCATTTACATTCCCAATGACTTCTGATAATGAATTGGCCAAGCCTTCCAGAGTTACGCATCGATGCTGTT
CACTGAAGTCTGGCGCATGACGAATAAATCCAAGTAAATCTCGAAGCAATTGCAACTCTGACGCTGCTTGTGCGAATTCACTCACAACATGGTGAAAGGC
CAAGGGAGATAAATGCCCAACTGCGACACCTAGCGACTGTCGAGATCGCTCAACCGTCATCGTCTGGAAATCTAAACTAAAGATCAATGGAGTCGGCTTA
ACTGGGCGAAATTCAAACAGGAGCGAATCGATGCCATCAAGTGCTTCGAAAACCATACTCACCACAGTTTGCTCGTGGATAAGTCTACGAGGGATAATAC
CACTCGTTGTCCACCCGCCCTCTGCACTCTTGACCACCGCTTCACACAAAAGCCACGGCCGGTCTAACGTAAACGGAACATGCTCACTCTTTTCCATCAC
ACACGTCGGATCTTCAGCATCATCAACCACCATATCTTCTTCATTTCGCAGCAAAACTTCTGGGTGATAACGGCACAAAACGTTATCCCGCAGCCTTTCT
CCCTCCGAGAACTCTCGTCTCGTTCCACCGTGCTCTGCACTCTCCCCACTGGCAAGCACACTGCTCACTCGAGAATCCGGCAGTGGCATCACCTCCTGTC
CCCCAATCGCATCACCCTCCTCTTCCAATGCCTCACTCGTCCTCTTCCCATTGCGGTGGCACGAATCGACACTGCGTTCCCTCCCCACGCTGCTCATTTC
CCAGTCACTTTCCTCGTCACTTTCCTCCCAGGCTTGGTACCACTCGTCATTGGTAGAGATCTGGAACAGCTCGTCCACCAGTTGATCCTGCATCTGCCTG
TGCTGCTTCTGCTTGAGTTGCTCCTGCTGCAGCACCGTTTTCCACCTGCTGTCGGCGTCCTCATCCACGTCCACATCTTCGTCTACTGCTGTTGTTGGGG
ACGTCGCCAGCTCTAGCAGAAGCTTCAGCACTTG