Description :
From Genome Similarity Track
Location :
Scaffold_266:646- 2375
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015083Protein of unknown function

Sequence
1729 bases(100 bases per row)
AGAAACGGTTTGCTGCTCAGGATTGGGACGCCGTGAAAGGCAGTCCATACTTTGACTTGCTGTGGGAGTTCAAAGATGTTTTCCCCGACAAAGTGCCAAG
TACCCTGCCCGTTGACCGTGACGTAAGGCACGAGATTGATCTCGAGCCCGGGAGCAAATATTGCGTGACCAGACAATGGCCGCTGCCCCGCGAGCAGGTC
GAGGCTATCGACGAGTTCTTCGCAAAACGAGCCCTCGCCGGTCATGTGAGAGAAAGCAAGTCTCCACGTAGCTCATCTACGTTTTTGTATGCGGAAAGCG
GCTGGTGTCTGGCGCATTGTTCACGCTTTCAACAAGCTGAACGCCGCCGCCATTCCGGCACAAACGCCGATCCCAAGAAAGGATATCTTGATCGACTCCA
TGGGCGGCTCGACAGTGTTCTCAGCACTGGATCTGATGGATGGGTCTATCATATCTCATGCGAGAGAATGACATCCTGACGGCAATAAGTACACCCAGCG
GAATGCTGTGGGAGTGGCTCGTGACGCCGCAAGGTTTGAAGAATGCACCAGCGACGTTCAATCGTCTGGTAACGCATCTTCTGCGTCCTCATCGTACGTA
TGCACCGAGCTATTTCGATGGCATCTTTGTGCACAGTTGTGCCGAAGGAGATCTTAGTGTCGTTGACGTGCACAAGAGACATTTGCGCTCATTGTTGCAG
TGCTTACGAGACAACAGTCTGTATTACAACCTGAAGAAGTGCATCTTTGGTGCCTCAGAGATTCCGATCCTGGGCTGCTATGTTGGCAAAGCTGAAGTCC
GTGCGGACCCAGAGAAGATCAAGGCGATCGCCGACTGGCCGATCCCAAAGTATGTCAAGAACTTGCGCAAGTGGCTTGGCTTGGCAAACTATTTGCACAA
GTATAGCCACAACTATGCGACAAGAGTCCGTCCACTCACACATCTCTTGAAAAAGGATGTCGAATGGGACTGGACAAACGATGTCATGAATGCATTCATT
GACGTGAAGGAGTCGCTTGTTCGCGCTCCTGTCCTGGTGTTGTCGGACCACACGAAAGCTTTCAGTGTCGTGTGTGACGCCAGCGATTTTGCAATCGGCC
GTGCGCTGATGCAGAAGGATGATGACGGCCATGAGCGCGTCATATCATACCAAAGCAGACTGCTTAAGGCAGCTGAAAAGAATTATCCTGTGCACGACAA
AGAACTGCTTGCGGACCGCGACTAACTCCTCCATTTATCGCAGCGAACGGCGCGATGGCTTGCATTCTTCTCCGAGTTCAACTTTCGGGTCGAATACAAA
CCGAGAAACGAAAATGTTCTGGCGGACGCGCTTTCGCGCCATCCAGATTACGAGTCGAGCGTTGACAGCAGCTCCGACGCGCTGTGCTTGGAGCGCACTC
TTGATCTCATGCACCTGAGAATCATTCAGTCGCTTTATTCAAAGGACAATGAATGTCGTTTGATGATTGCTCACTTTGACGGCTCGTCGAAAGAGTCATT
GCCTGCCAAACTCGAGTCAAAGCTTGCTCGGTTTAGTTATCACGACGGGTTGTTGTGGCATCGACTGTCCAACTTCGATTACCCGCGTATATATGTATCG
CATGACCAGGATCTGGAACTTTCGATCCTTCACGAGTTTCACGATGCACCAGCGAGTGGTCATCTCGGGCGTGAAAAGACCTTCTTGCAAGTGTCTAATG
TGTTTTGGTGGCCACACCAATACAAATGG