Description :
From Genome Similarity Track
Location :
Scaffold_743:646- 1910
Sequence
1264 bases(100 bases per row)
GACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAACAGCGCGA
CTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAA
CGTACTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTTGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCCGTCTTTTGAGCT
CGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGAT
GAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTTGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCA
GCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGATAAAGATACGCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGA
ACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAGCGTATCCCCTCCAAAAAAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAAT
CAAGGAAGACTGGTCTGGTTCTCCATTAGCAAATATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCA
GCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGCCGAGCTCAGCTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCAG
CAAACAACTGCCATCCTCCCTTTGGTTGAACATATCCCCATAGAGCGTTGTCAATCAGTCGTTGGTAGATCATAGGCGCATTCTTCAATCTAAACGGCAT
TCGTAACCATTCAAAGTGTCCAAGCGCACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAACCCACTCGCAGCATCGAGC
GAGCAAAACCACAAGTAGCTCTTCAATTCGGTAAGCAGGTCATCAACCAGTGGCATAGCGTATTTTATTGGTGTCGTAACCGCATTAACCAGTTTATAGT
CAATGCATAGCCGAAAATCCACACCATTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGG