Description :
From Genome Similarity Track
Location :
Scaffold_1:64595- 66908
Transcript NameFunction/comments
Phyag_g16phospholipid-transporting ATPase, putative

Sequence
2313 bases(100 bases per row)
CCAGGCTGACAACATCGCCAATGCAAGTCCGACACTGGTCTTAGACCGCGAAACGAAGAATTTCAAGCAAATCACGTGGGCGGACGTCGTAGTGGGCGAT
ATAGTTAAGGTGACAAACCGAGGTCTCGTGCCAGCAGACATGCTCGTGCTAGCAGTTAGTGAGATCCCCAACCAACCCCCGTGCGGTATTTGCTACGTTG
AAACCAAGTCTTTGGATGGAGAGACCAATATGAAAGTTCGTTCTGCAATGGAGGGCACGTTGGCAGATATGGGTTCTGTCGACAACTTGCTCAAGATGAA
AGGTGTTGTCCGTTGTGAGCATCCCAACAACGCCATCAACAGCTTTCAAGGCGTAATGGAGCTTGAAGGCAAAGAGAAAGCGTCCATTCCGTACGAAAGC
ATTATTCTTCGTGGTTGTATTATTCGTAACACGGAATGGGTGCACGGCGTGGTCTTGAACACTGGCAAGGACACGAAAATTATGATGAGTAACTCGGCTC
CACCGTCGAAAATGAGTTCGATGGATCGGTCTATCAACCAGTACACTGTCGTGTTGCTGACGATTTTGGTCCTATTCAGCGCAGCTGGCGCAATAGGCGC
AGTGATTTGGAAAGCAAACCACGATTCCGTGTGGTACTTGCAGCTTGGTGTGTCCGACAACAGCGTATTCGTGGATTGGCTCATCATGTTGTTTTACTAC
CTGCTACTCATGTACCAGTTCGTTCCCATTTCCCTGGCTGTGTCCATGAGCATGGTCAAGTATCTCCAAGCTCAATTTATTCAGTGGGATATCAACATTT
ACCACCCGGACACGGACACTCCGACACTGGTGCGTTCCATGTCACTCAATGAAGAGCTCGGGCAGATCTCGTATATATTTTCCGACAAAACAGGCACCTT
GACATGCAACGTCATGGAGTTTCGGAAATGCTCGATCGGTGGAGTTTCTTACGGCAACGGAACCACAGAGATCGGGTTGGCAGCTCTCAGGCGCGCTGGT
AAACCTATCCCAGACATGACTGCCCAGTCCAAGGGCCCTAAAATTCCTTACGTGAACTTCGACGGCCCCGAATTATTCAATGACATGAAAGGGGACGCGG
GCTCTGCTCAAAAGGGGCGGATCGATGCCTTCTTCACACACCTTGCGGTATGCCATACCGTCATCCCAGAGCGTCACGAGAACTCCACTGAAATCACTCT
ATCGGCTTCATCACCCGATGAACAAGCTTTAGTTGCTGGTGCGGGATTTTTCGGGTACGAGTTTGTGAACCGATCTCCTGGTATCGCGCACGTCAAAGTT
CGTGGCACGGTTAAAAAAtacgagatgctggacgtgttAGAATTCAACAGCACGCGAAAACGCATGAGTACAATTATTCGTCACCCCAATGGACGAATCT
TCTTGTACTCCAAAGGTGCAGATGTAATCATCTATGGGCTTCTGGCAAAGGACAAAGAAGATGAATCGATCTCTTCCCAGCTCCAGGAGATCACCCGACG
ACACATTGACCAGTACGCTGAAGATGGACTTCGTACGCTCACGATTGCAGTTCGTGAAATCGAGCCTTCGTATTACGATGAATGGGCGTTGCGCTTCCAC
GACGCGCAAAACAATCTGAACGAGAttgacaagcgcaagaaggatCTGCCGAATGCGATAGATGAATGTATGAGTGAGATTGAGTGTGGattggagctgc
ttggagcCACTGCAATCGAGGATAAGCTACAATCCGGTGTTCCCGACACGATCGCCAACTTGGCATGCGCAGGCATTAAGATCTGGGTTCTCACAGGCGA
CAAGGAGGAAACTGCGATCAATATCGGTTTTGCCTGCCAGCTTGTTACGAACGACATGAAGCTTTTCATCATCAATGGGAAGAATGCGCCGACCCCAGAG
ATACTTGAGAGCACATTAAGGGACGAAATTGGAGCTCGCTGCGCTGATGTCACCGTTTACCTGGCCTCCCCACCGAGCAAGAGAAGTGAGCTGCGGGACC
TCGCTTTCGTTATCGATGGAGAGACGCTCATGTACGCTCTGCGTGGAACATGTCGCCCACTTCTTGCCGAGTTTTCGCAGTACTGCAAAGCTGTTATCGC
TTGCCGTGTATCTCCCGCTCAGAAAGCCGAGATGGTTGCCCTGATCAAAGAGTATGTCCCTGGCGTCCGAACGCTTGCAATTGGAGATGGAGCAAACGAC
GTTTCCATGATCCAAGAAGCTCACATTGGTGTTGGCATttctggccaagaaggcatGCAAGCTGTGAACTCGAGTGACTACGCCATCGCCCAGTttcgct
tcttgcagcgctt