Description :
From Genome Similarity Track
Location :
Scaffold_4:64593- 68287
Sequence
3694 bases(100 bases per row)
ATACTGGAGGCGATTACCTAGCACCCCAATACCCTCTTAAAATAATATGAAGCGGACTACAAAGGAATAGATGTGTCACCCCAGGGCGCTCAAGGCCGTC
GCTGGTCCCCACCTAACTGGACTTAAGTTTGATGGAGCGCACACAGACGGCTGTCCATGCCGTTGATATGTCCTTAGCGTCCCACGCTCGTAGTCTCAGG
TCCTCCGGATTTCGGTCGGCATGCTTGGCTGAAGTTACTAGGGAAAACTAAACCCTGTCTGTCTTTTATCAGCTACTCCTCTCTCTCTCTCTCTCTCTGG
ATTTAGAGAGCCTGAGTTCACGGTCCGACTCCAGAAAACCGTCTAGAAATCCTGGGTCACCGGCATCCAGGCAGATGAATTCTGGATTTCCGCGCGGCAC
CCTGGGTGTCAAGTTCTCTCCATCACAGACTCACGTGTATCTCACCAAATATCTGGCCGCCTGCGCATGTTCACGGGGGTAGTAGCGGGGTTTTAGGGAT
TTGATCCATTGTAGTGATCAGGCCTGCAGCAAGATGAGGTGTACTCTGGGATACGTCCGCCAGAGACACTTTCCGCCAGATTAGGCGCCCATCGTAAGGG
AAAATTGGCGGCGGGACTGAGTGTTCTCTGGAATCCTGGGTGTGCACTCACAGGATTCACACTTCCAGCAAGTTGGGCCCTATCCCACGGAATCACATCT
ATCCCGCAGGAGTCACTCTTGCCACAGCAGTGCCACATCCAAACCATCCACCAAACAAAATCGAATACAAACTCCAAGTCGAAAGGGTGACGACACAGTA
GCGGGCTGCATTCGTGTTCAGTGGCGTGGTCCCGTCGTCCATGATCCAACGACTGCACTTTTCCCGCAGTTGCCGTGGACAGTTTGACGAACAGCAGTGA
CAGCAACAACACCAACGCTGCTACTACTATAACAACTGCTGCTACCGTTGCCTATGCCGCCGTTACGCCGTTGGATGCCGTCAGTGTTGTTGTCCCAACT
CATCGTTGGTATTGTTCTTCCGGTTGGTGCCGATTCACGACCTATCGATGTCAATGACAGCGGGTAACGGCTTTAGTTGTTTTCGCAAGTAATACCTAGA
CTACCGCCTCAAAAATTGGCCCATAGTTTTATTCTTAAAAATGGTCGGCCTTAGTAGCCAGGTTTCCCAGATTCAGAATTTTCTTAGAAAATTGATTCCA
CAGATATTATCCACGTTTTATTCCAGGGAATCTACAGATTTCCCTAAATCGTGCAAGACCCCATCAAAGTAATCTATGTGACCGGCATAAATTTTCTGAC
CAGGTACAATGGGGTGAAAAACCTGGAATAGTTATGTGTGCGGAACTTTGGCAAAAGTGGAAGTGACTGCATCCGGCTTGTGTCGGAAGAGCTCTTTTCC
ATCCCAGCTCAGGGGTAGAATCCGGATTTCGTGCAGGTATCGATACCTGCAATACTCATATGTGCGCTACTCGAGTAAAAGCGACGTCCGTCGGCATGGC
GAGAAGCGCCAAGTAAAGCTATCATTCTAGTATGTCTCCATCACGTAATTTTAACTGTTGTCCAGATGTCGTCCAGGAAGTATCCGTGTATTAAGAGTGG
AGCCTCCAAATGCATTACGCCTTCTTCACTTCTTGCGACTAGCGGCGATCCACCTTCAGGATTGTTTTCAGCATTGCCCAGCAAAGCATGATGATACCCG
TTGGTGTTACATCACTTGGAGCGCTATCGCTGACACAGGTCCAGAAGCAGCAACACACGAATACCACTGCCCGACTGAAGAGACTCGACCCCCTTGACAG
TCGTGTAGCTGGGCGTAGTCGAATCAGCAGTAATAATCTCACTTGCTATCTTCTTCAATCGCTTCTTATTACGCTTGCCATTCTTGATGTCGTACGTCTT
CCCTTTTTTGGCATCTTGGTCGACAATGAGGCATCTTCAGCAATATTTCCCAAATTTGACGGGTAGCAGCTCAAACGCATGCGTCGAAACATCTGCATCG
ATGCTTTGGGTGAAAGCAAGCCCTTGCGACTACTTTTTCCTGTTTAGCCTCGCCATGACCTTGTGACGTGGCCAAACTTGCCACATGATTCTTGTACTCT
ATCTCGCCAAGCGGTGTATAATTTCCACAACCACCTCGTTGATTCAATTTCGCCATGTGTGGACAGACCAGCCTTAGCAATAGCCTCCACATAGCGATCA
CCGTCTGCAACGTCTTCGGCGTCACTGTCTGGTCGATCACCTCGTTTTTCGCAATGGCGACAAACCCGCAAGAACTCTCCGCTTCTGCGGCCGAATCCCT
GCTGGGCTCGACGATACTGTTCACTCTCGCTCAGAGCCGAGGTCTGTCTTGAACACCTTTGTCACCAAAGACTGTACAACCTCAACTAATACATACTCTG
CGATGCGATTCCGGCTGAAACATCTGCAAATACAACCAAAACACGGTAGACATCTGATCAAAACCTGAATCACTCGAAATATTTGACCAATACACAGGTA
AAACCTGGAAAAACCTGAACATACCTGGGCCATATCGACGAGAAGGGGATGACCAGAGGGTTGCCGATACACCATCGAGTGTCTGCAGGACAGCTTCATG
GTTTGTGCGAACTCACAGTCTCTAGTAAATATTCGTGCTCATCGTACTGGACGGTGATCGTAGTACGGTTGTCTTTGATAGTTATCAGCAATTGCGGCAC
CAGTAGTGACGTCATACTGCGTTTTGATCGCCGCTGCTACCGATCGCGTTGCCATACCGAGTGCAATACTCATCTGCTCACAGTACGAGACGTCTCGCAA
CGTCCCTGGTATCTCCACCTTGGCTTTGTATTCTTCTTCCTTGCGTCGCTGGTAGGCCAGTAGATATTTCATGCTTGCACACTTAGTCAGATCGCTCTTT
AAGTGTAGTGTTTCAGCTTCTTGAACATGCTTTTCACGCGATGGTTGGTATGATTGTACGTCATGTCGGTAGTGGTGTGCTTTATTTGAGCCTGCACATC
TTCTTCGTACACACCATACTTCTTTGGGTTTGGAATTGTTTTGTGCAACCACTTGATCACATGGAAGTAACAAAGTAACCCGCGAACCTTAGGAAACCTC
TTGCGGATGACATCAATTTCGCGCATGCCCTTGTCGACGATGCCAATCCGCACGAAACACCAGCGCTCGTTCGCCCGCTTAAAGTCCTCCATACACTTTG
CCATGTACCACAGCTTTTCGTCTCGATCAGCGAGTATACACGTGTTGCCCGTTTCCGTATTGGCCCATCGCAGTCATCGCGAGGAGCTGCTAAATATATC
TAGTCGATACAAGGAACACGCCCTGGTCAAAAGTTGGTAATACTTAGCCAAAACCTGCAAATATAATACAGAGACTTACCGGTTAGTCTGATGCGTGCTG
TCCACTTGAATCACCTCTGGAAATCTCTCTAGCATTGCGAGTATATGAACACTCGAGAAGGCTATCACGCCAGTCTCGCCCTGCGCGTTCTCATGCACCG
AGGCCACGTTTAGTGGTGACATTCACGATCATCTCCGCTACCGTGTCGTCGTCAGATGGATCAATTCCTAGTCATCAATATCCATAAAGTCAGTTTTACA
ATCTAATCATGTTATCACAACAATAACTAGTCTTTCTCGTGCATCTGTGCGACCACGTTTCGAGCGTCTTTCATCTTGACGAGGTGGTTGGACT