Description :
From Genome Similarity Track
Location :
Scaffold_5:645633- 650628
Transcript NameFunction/comments
Phyci_209904Hypothetical protein
Phyci_76704Hypothetical protein
Phyci_101084conserved hypothetical protein

Sequence
4995 bases(100 bases per row)
TTGGAGCGGAACTCGTCCGTGTTCATCTTGTATTCAATCACCGCCCAAATGGCACCAAAGACTGGAATCGAACCACCGATGACACAGAACTTCCACATAT
TTCGTAGCAAACGTCGGAATCCAACGCAGTTAGTGTTTCCACGCGTTGAGTGCCTCAATGACCCTCGCATCTCGGCTCCACGGCCAGTCCCCCAATAGAA
AATGACAAACAGCCATACCACGTAGCTGAACGCGTACGCAGCATCCCCGACAGCATTTTTCCACTGGTATGGGGTCCCTCTGGCGGAATTCGTTGCCGAC
GTCGGTTTGATGTAGCCGCTGTCCCCGAAGTCCAACTGCAGACTTGTGACGGAGTACCCCTCGAAGTCTCCGTTGTAAGTCGCGATCGTGACTTCCAGCC
TTTTCGTGTAGTAGTTGACTCCTTTGTCACTTCTCTTCAGCGCCGAGATGGCTTGGGTTACCTCAGTAGCATTCAGGTTGATGCTGAAAAACGAGCGCTC
GAGCGTTGTGCTATCGGAATCCGAGCAGTTTGGGTATAACTCCGTGACGACATCGTTGGGGTTGCACGTCTTAGCACTTTTGCGCGTCACATCGAAAATT
ACACCACCTAAAACCTTGTTGAGCGTGGCAATTTGGCCTTGCTGATACTTTGGCAGGATATTTCCGTTGACGTCCTCGGTGATGAACACCGATGGTACCA
TCGTGTTGACGAGCCAGTCGTACACGTCGTCGATGCTCCCTATGTTGTAAAACTGCATCGGCGTATCGCTCGTGACGATGTTATCGCCGTTGGTTGCTAG
GACACTCGACACTGCAAGAACCTGGTCCCATTGCAACGTTGTGCGTGGCCGCCGTGACAGCGCAACGGAAGCGACACACCAGAAAATCACCGTGCTCACC
AGCCGAATTAGCGCTCGCCCGATCTTGGCATCCTGGCTAATGGAGTCACACGCATCTTGCATCGAAATCTCGAAAGAGCCCGTAGAGTGACTGGAGTTAG
GTTCCGACACCCTGTGCTCGTCTATATGATCGTCGTCGATCTGAATGAACGTGTCGGCTGCAGATTTACCCATTCTCGGAAACTGAGGACGTTTTCTGAT
CGCTTATGCCCGAGGAAGACGATTTAAAAGTGACGTCGAGGAGCCTCACGCGAACCTAGACGAATGGACCCATGGGGCATGCAGTCTGCATGCGCCATGG
GTCCACTCGAAATTGACTGCTGCATGATGTAGCAGTCAATTTCATGTGCGACTCGAAGAGGTGCATCAACGCTTCGATGAACTCCCCGGTCGTGCCAAAT
GAATCGAAGACAGCCCGTCTGGCAGATGAGCTCAGGTTTGATTAGTTGCCTCAGGCAACTTGCCTGAGCGTAAGGCATATACTATGCAATCACAGCAGAA
AAATCGCGAATTGCTGCCGGTGGTTACTACACGATATTATCTAACTAGCGCATTTTGCGCTAGTCGGTCTTGAGGAAACGAAATGGTGGAATTCCTCGGC
AAGAATTGGTGGGATAAACGATCTCGAGCTGAGAAGCTTGGAGGTTGAAGTACGCGATACTGACGGCACGGCAGTGTGTAGGTGGTACGGGCTAGTGGGA
GGCGGCGAATGCCTGCTTATCCACTCATGCGAAGAATGGCTGCGCGAGTGCCACAATTTCTTGCAACTGTAGACGCTTGCAACTGGTGCCGGTGAGGTGA
AAAACTTCAGGCAGGATCTCGTTGTCGCGAACATCTCGGGCCAACCATCGAGCCCATTCGGTTGACGCCAATTTGAAAACTCTTTCGTGTTCAGGGGCAT
GACCAACGCGAGCTGCTTTTGGTGGGGTGTAAACGGAGAAACTCATCACACCATTGCGATCTGTGGCCATGCAGTAGACGTTTTGCTGGCCTTCACCAAA
ATCACCGTCGGTAGAAAAGGAATCCTGTGGCCGGTTTGTGAGTGTTGTTTCAGATACTGGGGTTACTCCACTCGAGCTCTCGGTGTTGCCGCTGTCCTCG
ATATCACCATTGTGGTGAAGAATGTCTTGTTGTTTGGCTTCACTAGTGACAGCGCGAACGACACAGTACGCTTGACCACGTTGGACTAATGCCTGGTGAA
GACTGTCGTTGGTGGTGTCAGCGGTGCTGACATTCGTGTCAAAATCAACTTCGTGTTGATAATTACTGATTGACATGACCAGCGCATCTGAGCCACGCTG
GCCACGCATCGAGTCGGTGACATTTTTGACTCGTGCTGCCTGAGTATGGCTGCCATTGTCGGAGTCGCTTCCGCCAGTTCCGATGGTACTTGCTGTCTCG
TTGCGAGTTCTCCTAACCACTTTGACGCCTCTTTGGAAGGCTTCACGGAGAACTGCAATCCAATGGCCGTAAATCTCAGCGGTGGGCGCGAGGAATCGAA
TTGTTTTGCCTTTCACGCCGTACCGAACGCCAAAGCGTAGCTTACGACGATCGTTAGCGGATCGGGGAAGAAGATCGATCGGGAAGTCTCGACGACCGAT
CGGCAGATCGATGCGACCACCGCAAATCGACGGCCGTTCTATACGGAGCACGTACTTGGTATTTCGACCGAATGCGAGTACGTTGACAAGGAGGATTGTG
GTCTTGAACCAGAATGGGCCGAATTTGAGTTTCAATACGCCAGAAAACGCCATGGTGCGCGCGTTACGCGTGAAACTTCGAATCCGTAACCTTTGTTGTA
CTTTTGCTTTGCGGAAAGAGATGAAAATTCTCAAATGAGCGCAATTCAAGGGGAGACCGTAAAGTCCGCCACTTGAAAGCCAGCAATTATCGGAACCGTT
CAGCTGTATCGCACCGCACTGCAATCCGGGTGCAAGGGGCACGAACTCCACCATGTGTCTCCGAAACGCCTTTCACACCAATAGCGCTGTGACTGAAACT
CTAGAAAGCAATTCAGTTGAACTGGAATGATCTTTCGCTTTGCCTACCATCTGGGAAAGCTTCAACTGTGTGACACGACTGCTACGCTTCTCCTGGTCCC
AGCACGTTGGGACCGCCTTTGATAAGGCGACAAAAGGTGTATGATTATTTCGTCTACCAAAGTGTGGCGAACCTGTAAACTCATTTTTCAGCAGCAAACT
TCAGGCAAAACTTCGATCATCATGCCGTCGCATGTTCTCTCGGGCAACATTTGCGTTAATGATGGAGGCAGCTAGCGCTTCGTTGTTCGTCGCTGTTCTC
TAATACACGCCTAATAAAGCGTGGCATTTTTCTCATTTGATGGTCGTAAGTTGACAATGAGGGTCTACTATTCGAGGCATCACGTCAGCACCGCGTGAAG
GACCTGACGAGACGGGAGGCTCTGCTGCACTGCAGATATTGCCAACATGCTGCGCACTCTGGGGCGACAGCGGCGCGGCTGGCGACTGGCCGCAGAGCGC
CGATCTGTATTTTGTATGCGGGGGGCGAGCAGCGCTGCTGGCCCCAATGACCGACAGGTGGGGGGAGAGCATGCGTACCAACTTTTGTCACGAACTTTAA
CCAATTTTTGCATGGCAGATGTCGGTGGTAGAAATTGGGGGAGTGAAAGCCAACGTCGGGGTTGCAAAGGTGAGAGTACGAACTAATCCCTACAGTATTT
TCATTTATATTTAAGAGAAACAATGTATTACGTGAACATTTCGCTGCAGTCGATCGAGTTGGTGCCTCGTGGATACATGACGGAGCAGCAGCAAGGGCGA
CCGATGTCTCAGGTAACGTTATGGCGAATTGGACGCTGGATTTACTCTTTACCATGATTCATATTTCCTCGTGTAATACATGTTTTCAGGAATTGCTGGG
TCACTTGAGATGGATGCTGCAAAAAGACCTCCTAAAGCAAGACATGTTCCTCATTGGGTACGTTGACCCCTGCAGACAAGAGTTGATTTTCTTGCTAAAA
CAGCTTCTTGATGTGTGCTTTAGCCCTCCGGGGTCGTCTCGACGACTGCTGAGTATGAGGTTCTGCGAGCTTCTGAACAAGGAGGTCGAGTACATCGCCA
TTTCCCAGGATACGACGGAGTCCGACTTGAAGCAGGTTCGTTAATAGCAAACTTCGCTACTACCGGAAAGTTACAGTATTGCCGTCGATACTTACTATGC
ACTTACTTGGCCGGCGTATTTATTTTTCTAGCGTCGAGAAATCGTGGATGGAGCGGCCATTTTCACGGACCAGGCTCCAGTTCGAGCAGCTATCAACGGC
CGAGTGCTTGTGATCGACGGTTTGTCCCAATTGTCGAGTCCCATTTCCATCAACTCGGCGTAACTGGGTTTGTGTTGCCCAGGACTTGAAAAGGCGGAGC
GAAATGTATTGCCAACCCTGAATAACCTGCTTGAGAACCGAGAGATGATGCTTGACGACGGAAGATTTCTCATGAAAGCAGAAAGGTACGGGGTAGTTTA
GATTACTGCAGTGGTCTACGCCCGTTTACAGCCAAATGATGTTTTTTCAACGCAATCCTGTGGATAACGCAGCTACGATGCGTTAGTGGAGCAAGGATAC
TCGTCCGAAGCGTTGAAGGCGCAAAACCTAGTACGAGTCGATCCGGACTTTCGAGTGATTGCATTGGGTCTTCCTGTTCCTCCCTACCCAGGCCGGACGC
TAGATCCACCACTACGCTCCAGGTTCCAAGCGAGGAATGTTAAGCCAAGCTCTCCAGGGTCGCAGCTTGAGGAACTGGTTGCTGTTGCCCCATCCGTCCC
CTTGCCAACACTTGAAAAGCTAGTGGGCATTCGAGAGGCGGTCAACACGATTGAGGCTACCTACGACATCGGTACCAGTACGGGCCCACGTATGCCACAC
TTTGACTACCTCTCGCTCTCCCACTGTGCAAAGGTGTTGGAGAAGTTCCCTGGTGCAAGCGTGGCTAACACCGTCGAGCGTGCTTTTCCCGTGCGAACCA
ATGTTCTCGGCGCAAAAACTAAGTCCAACTCGAAGGCGCTTGATCATATTCTGGCAAAGTATACAGACGGATTGAAAGCCACAAATTATCTGCTC