Description :
From Genome Similarity Track
Location :
Scaffold_133:64525- 71943
Transcript NameFunction/comments
Physo_143248reverse transcriptase
Physo_109548reverse transcriptase
Physo_143250hypothetical protein

Sequence
7418 bases(100 bases per row)
GTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCA
AGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTA
CGCTCAGAGAGCATGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCT
GTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTCCGGCAGGCTAAGCTGCATG
CACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCA
GGGAAACAATGTGCGATGCTACCGTTGGGGTAGAGTCGGTCACTTTGCACGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCC
GGGCACCGTCGCAGCCAAACAAAAAATGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACT
GAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGC
TCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTA
TGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGGGCTTCACGTATGAAGATTAAGAGTTTGGCGAGACCTT
TATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCGATTGGGAGAAGCTCACTCTCGTG
CGCTTCGGTCGCGACAGCGGAACCGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGACACAGCGCCTAATG
CCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCTGCCGACAGCTAATGAAGGAAATTTGTTGACCTT
GGAGGTCGACACCCGCTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATAACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACG
CGAATCTGATTGGATCAGGTCTGGCCAATAACAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGCGAATTTGATTCGTCGGC
TCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATGGTTGGCGTCGAGGTATTGAAGTCGCATCGACTCCGGGAGTCGATAGCTTGGACGAA
TTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGACTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCG
ACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGC
CGGGCTTGAAGTCGCTCGCCCGCGGGACGAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGCTAAGAACCAAGCGGA
GCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGATCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCAGGGCAGACGG
AGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACTTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGC
GTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAG
AGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGAGAAGACGAAGAATGAGCGCTTTG
AAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACGAGATCTTACGGGGGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCA
GGATAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTTAAAGCGATCGAC
GACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGC
GCATCGTTTATGCGTATAACAAGTTGAACGATGCGACGATACCGGCACAGACGCCGATACCTCGAAAAGATGTCATCATCGATTAGATGGCCAGGAGCAC
TATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTC
TGGGAGTGGCTAGTGATGCCGCAGGGGCTGAAGCACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGA
GCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCCACAAGGTGCACCTCCGGAAGTTGCTTGCGCTTATGC
GCAAGTACAAGCTCTATGAGAACCTGAAGAAGTGTATCTTCGGAGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGA
CCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTATGTG
AAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCA
AGCGCGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTT
GATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACCCGGTACATGACAAGGAGCTCCTT
GCTATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGT
CGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGA
CGCGCTCTCGCGTCGACCTGACTACTCCACGGCTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGAC
GTGAAGGTCGCGTACGCGCACAACGTGGACGCAAAGCTCTTGCTGGTTTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTC
GTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCT
GCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTACGGGGCATCCGGGCCGTGATAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCC
CACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAA
CTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTT
CAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACGTGGTGTTCAAACACCATGGCATGCCG
ATCAACATTGTGTCGGATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGCAGTCAACTTTCGATGTCGACTGCGGACA
ATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCC
GATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCAAACACCGTTCTCATGAACGCCATCAGGCACCCACGCCTCCCGAGTCTACTCG
GGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCG
CAAGAAGAACAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAACGGGTCTGTGCAGAGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACG
CAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGG
TAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTT
GCCCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCACCTAGCATGCGCCTCCATCCGACCTTTTACG
TCGGGCAGCTGAAGCCATACCGGCAGCACAAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAACCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACG
CGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGATCGCCACCTCCT
GCTTTAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCTTTGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACACGTGTTCCC
ACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACTATAGTTTCCCGAAAACGAACCGGCAGCCGGTT
CGTTATCGTATTCGTTGGAGAGGGTATCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACG
AAGCTCACCACGCACTGCCGACGCGAAGGTAGTGTGAGCGCTGTGGTCACCTACAGCGCCCGAAGTCCCACGATCGTCGCGTTCCTCACGTGCCAAGAAC
TTGGCACGGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGC
ACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAAGATCTGTGGAGCTGCTCCAACCTCCCGCGCGTCGAGAATGTCTCTAAGCGTTC
ACAGGCGTGCTTAATCCGCTCACGGTAAGCAGCCAGCTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACT
TTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAATAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCT
GCTCCTCCGCCACAGCATCGTCGTGGATGCCGCTGCATACGTACAGCGAGATTTCATTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGC
AGACGGCATCCATGGATCGCGCGCTGCTCGGGCAGCGCGCGGAGAACTTGAAGACGCCATCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGA
GTTTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCACTGT
CGATAGACTCCTTGCGCTTGTTGGGAGAGGCCTCGCCCTCTTCCATCTCTACGTCGTCACTCCCATAGTTAACGGCATCGTTGACTGCAGAGGAACCTTC
GAGGACAATCTCCGACTGAGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCGTCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGAGAGGTTG
CCCTCTGTTACGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACATGAAGAATTGACGAATGGTCAATTT
CCTGGTTGACGTGCCGTGACTCGGTGCGTCTAACCTTGTGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACA
GATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAATGCTACATACATTTACGACCACCATGACGGGTGGTCCATAG
AGACTTAGGATTCCTATTGGCTGAGAACAGCATCTCTTAGCCAATGAACGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATC
TTAGAATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAATAGCAGTTTTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAG
ATTAATCTATACTCGGAGACCCGAGTATAAATAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGC
CAAAGTAGGCCCATTACA