Description :
From Genome Similarity Track
Location :
Scaffold_867:6451- 10208
Transcript NameFunction/comments
Phyta_totarag11113hypothetical protein

Sequence
3757 bases(100 bases per row)
AAACAGCGCACACTGTCGATTCCTCAAAACAAAATCTCCAAAAGTGTTGGTCGCATCAAACACTTCCTAGACAAAAGAGCTGCCACACGCACGGAGCTTC
ATAAGATACTCAGCAGCTTACCCTACATTACGACTTGTTTTCATACAGCCAAAATGTttttgcagcaacttcacttGGCTTCTGTGCGTTGGCCCCGTTT
CGGTCGTATCCGTCTGCCACCAGCAATTGTCACGGACCTCCGTAGGTTCCAGCACATTCTGCGCCACGGCCCCCTTTCGAATTTACCTTTATGCATGTTC
ATCGCGACATCAAAGCCATGCATCCATGTCTACATGGACGCCTCTGGTTTGGACCTTGCTGTGCTAAATCCCACGCGCGACGAATTTATTCAAATCCGct
ttgacgaagaagaaatccAGTCCATCCATTCAGGCTCCATCTCTATTAACGTTTGAGAGCATCTGTGCATTGTACTTGCTATTTGGACCTGGAGGGAAGC
ACTGGACCTCCCAAACCGACTCGGCAGTACATCATATCCGATGTTGGAGCGACAACGCATCAGCGGTATCGTGAAGCAACCAACTGGTCAGTTCCTTTTC
GGAAGCGCAATTAATCAATCAGGCTATTGGGTTTGGAGAGGCGGTATTTAACATCAGGGTGTCACCAGCTCACTCACCCGGAGCGAGAAATCGAATGGCC
GATGCAGCTTCTAGTGCCTGGTGTGAACCGTTTGCATCATTATGGTCTAACTTCTCAATCCATTGGTCACAGGTTCACGTTCCCCCAACATGGAGAATTT
TTTTACAAGACGTTCTCATCAAACTGCAATCCGAATcgctggcctcgtcgtcAGCCGTCAAATACGCCGGTACATGGCAACAATGGACTGAGTGGTGCAA
CGTCATGAAGTTCTCGCCGTGGTTATCCAACAACAGAACACAATACTCATATCAACTCGCGCTGTTTGCGGTATTTTGTTGGCGCTAGGGTTTTGGACGA
CCAGGACAATGCACTCAGCGTCGGCCATCCTCTCCAAAATCAGCCACATATCGTGGAATCATCAGTTCAAGCTCGGATTTAGCGTTGGACTACTCCCAGG
ACACAAACTTTCTGTCATCGGCATGCGGTGACGCGACTACCCTTCCTCGAAGAAGCGCCCCATCACCATCCAAATTCACGAGCTCTCCATCGCAGCctca
acttcagcaacaccCACGACCGGGTTTTATGGGGCGCTGTGGTCTTGGGTTACTTCTATCTGCTGCGGCGCTCCGAGTATCTCGCCCAAGAACGGAAATG
CAACACAACGCAATTTCCCGGGCAGGTGTGCTAGTTCTAGATGACAAAAGCAGACTGTGCACAACACTAGCCACAGCCACGAACGTCACAATCCCCTTAC
GCGGAAGCAAAAGCCACCAATTCGGGGAAGTCACCACGAGAACACTGGTACGATCGGGATCAACATGATGTTGTCCCGTCGAAACAGCTTGATTCCTAAA
AAAACACCAACACCATGTTGCGCCAAGTATCTGAGCACAACAAGCTCCaagtcgacgacgtggtcgCAGTGTTACGGCAGGCGGCAGAATCGGTCGGTGA
AAATCCGTCTCGTTTTGATTCACATTCACTACGGAGCGGAGGAGCTCCAGCGCTATTCAATACCGGTGTAGACAGTCTAGCCGTCAAGAAGTTTGGCCGA
TGGAAGTCCGACGCTGTGAAGCGGCCCACAGAAATCAAGGACGACCTAACAACGTCACTCGATCGAGAGATTCTCGGTCACCATGTTTAGCAAGGATCAA
ATTTGGGCAACGTCCACGCCACTCCTTGGCAGCGGAGCGCTGCTAATCAAGCTTACCTTCAGCTCCATTGCGGGACGATCCCCCAAAGCGATCTGAAGAA
AATGAGCCTTGATCCGATGGTACGTCCTCTCGATACATTGATGTCCACCTTTCAGGCTGATGTGGTAATGATGTAGGGCGTCTTCTTGTAGCGTTTCGGG
AATCACCAGCCGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGAACGGCGGACAGTAAAACAGCAAGCCTGCCTCGTCGTTCACGTAACCTTCATCA
ATCTTAGCACATGTCGTGGTTACTAATGAGGTAAGCTGCTGTACGTCCCCACGCAAATACTGGTTGAGATCAACGATCCACTTCTCTTCGTCTTGTGTCA
TGCAAATTCACTCTTCCCCCGATTCGTTGAACAATCTCCTCCTGTAGGACTTCCGGAGTGCGTCGCCTACATGATCACGTCACGGCCATGATCTCAGAGT
TGTGTGATCGTGGAACTAGCATCTCGTCGAAACGGTTAAGCGTCACCAAGTCTTGGACCTCATATTTCGACATCACTTCCGTGCCTCCTTCACGCAGAAG
AGTGGCACCAGTGTCCCAATCTCGCTTCATATTAAGGATTCGTGATTTGGCCACGATCTCAGGCGCTCCATAGCCTGTTGGCGTAGTAATTGCAACCCCC
GCGCATTGCACTCGATCTCACCTCGCATCTGTCGGATGACTAAATTCGAATCTCCGCAGATGATATGCCGCCCCCTGTCCAGCTCGACCAGAAGATCGAA
GCATAGGAGCAAACCGGGTATTCCGCCTCGCTGACCGACATTGTCCTAGCAACATCTCATCCGCCTCCACGGTAGGTGTCGGCATGGTGATCACCTGTCG
GGGACGCTTCATGGGTACTATCGACACCAATATCGCGTCGACCTCTTCACGAGGCGTGATACTCGCGGCCATTACGCCTAAgatctcgtcctcgccctTG
TTCGACTTGACGATATCCGGGGTCCAGCTCACTAGCAACGCGTCCCAGCGACCGAGTCGTCCTTGCAATCCTGATGAGTGTAATAGCCACGCCAACGGGG
AGTGTCGGACCAGTACCTTAACCGATCTCGTCGCTAAATGCGTGTACCAGACATCCAAGATcatgagcagcgcgagaaccTCGTTGTCGACGATTCCATA
GTTGATCTCGTTAGGCTTGAACGTCCAGCTAGTAAACGTAACCGGTTTATATACGCTCTTATGTTCTTGCATTAACGCAGCCGCGATCGCCCACTTAATC
GCATATACCACCATCACCGGTCTTTGGGTATCTGgatcgaagtgctgcaagatTGGCGCTGTCGAGATTGTGCCCTTCCGTACGATGAATGCCATGACAG
CTCGACTCCGCTTTTCATTGTCATCTGTTGATCGAGCTTCACCGCGCTTGACTAGCCCAGATACCAGGTGCAGTTTCGAACATATCGCCATCTCACAGAA
ATCGGCCACACGAAGATCATGCAGGACCGACGCCTAGATCGCGAAATCCTAAATGAAGCGTCTGGAATAGTTGAGACTCTCCAAAAACGGCTGCATCGAT
CTTAGCGTAGTCGAAAAAGGAAGATTGGCCAGCGACAACAGGTCCTTCGGATGCCGGCCTGTCTGCAGATACTTGATGGTCCCGGTAGTCGACCTTGCGT
AGACCCCAGAAGCTCTTGGCAACACTGGTAGATAGGTTCCACTCGTCACAGGCATctagcagcttctccacctttCGCACAATATATCCACAAATCTGCC
GCCACAAGAATGTCATCGAGGTAAGGTCGACGACCTAGCACCGACGATTCATTTTCTACACCAGGCTCTCACTCCTCGAATACGTCGGTCTGGTTGGCGT
GATCTTAATTGCTCGTGACCTTGAGAAACCCATACAGCCGGTTGTCAACTAGTCTCT