Description :
From Genome Similarity Track
Location :
Scaffold_245:6450- 9438
Transcript NameFunction/comments
Phyag_g3901conserved hypothetical protein

Sequence
2988 bases(100 bases per row)
CCCGGTGCAGGAATTGCTTTGAACGCAGCAGAATTATTCGTGTCAGGGACAAAGCTACTCTCCTTTCCACTCGTTGACGCCATACGAGCGTCTAAGAGAG
TAACATCCGACGCTGTCGGTGAGACGATCGTGGGCCCCAAGATATTGCGAATATTGTTCTGCGATGAAGCTGGGTTGTGGGCTGAAGAGTGACTGTCAGT
TTGAAGTAGAACTGGGGCTATTCGCTTTTTGTCGTTCTTGCTTGATCCGATTGGGGGTCTGGTTTGGGGTGTGTTGGATGCTGGGGTGTCAaccttcttt
ttcttctttggaATGAGTGTGTTTGTTGTGTGAGTCACTGTTGACGCAGCGCCAGAACCAGAATTCTGACTAACAGGCACCCGTGGCGATGCCGTCGATt
tttcttcaagctgcatgCAGCAAAATGTACTCAGTTAATAATTAGCCTTGTCCCACGTCAACTGGCAGATGGATCTAGCACACCTGAAGCTGGATTGGAT
TCTCCACCAGTGTCGATGCTAGCGTAATGCCCGCTCGGGATCCATACTTCACAACAACCAAACAATAGATTAGGAAAGGTTAGCTGATGCCACGGGAATT
CATTCTAGCAAAACAAGCACTTCTCCAGGGAATCGAGAGGCCATTTACCTTTGTCTGAAGCAATTTACTCTGCTGCGCATCGGAGATCGGGGTACCAATC
TCGTCGCCTGCAAACTGAAAGCAGCAGATAGATCCATCGAGCGAGCATGCGAGGAGAAGTGACTGGGAGCTAGACCAAGTCAAATCCGTGACTGAAGAGT
CAAAGCAATCCTTGATAACTGCTAATGGACGAGCCAAGTGTGCCAGCCAGATGCTTACAGTCGCATCCTCGCCACCcacggcgcagcaggcgaaCTCCTT
ATCCGGGTCAGTTTTTGTTACTGCATAGTGAAGTACAGAACAAAGATTATCAGCACGAATCGGAAATTGGTAAAATCTCTCGCCAGCCGTACGGACCGAG
TAACTTGGGGTTGAATCGCGCACTTGTCACCACGCCCTGGTGACCTACAAACTTTAGGTCGTTTGTCCAGGACCCGCGATTTAGCAATGCCGCGATATTT
TTCTTGGAACTGAAAGCGTGCGTGGCACAGAGGACGGAGCCGTCAGGAGACCACGAGAGCCGACGGAAGTGTGACGTGGAAGCACATCCCTCAAACGGCT
CCAACACAACGTCGGACTCCTGCCAGTCGGCCACTTTCCACATCCGCACCGTTttgtcttctccagcactcGACAGATACTGCAGCACAGCGTAGCACGA
GGCCGTCAGGGACACTACACATAACCTCCCTTTTTCACACCTTCATTGGCCTACCTTGCCAACAGGATCCCACGCGACGCCCTTGACCCAACCGTTGTGT
CCTGAAAGCGTCTGCAGTGGCTGCGTCATGACCTCACTGAGTCCGCCAGCATCCACACCCCAGATTAAAATGGtgttgtcgatgctgcaggtggccaGCA
TTCGGTCATCCGGAGACCACGCCACGTCCGCCACATCTGCCAGATAAACAGCCACCAGTATTAGCACCGTATTCCACACTCAACTCCGTCGCTTCACCCA
CCCATCGTGTGTCGTTCAAGTGTGGAGCAGCGCACCCAGTTCTGTTTGTTCGGTCTCGCATTGGAGCCAAAGGGAACGGGGGCTGGAGCGCCTGACTGCA
GCTCGTAGAGAAGAACCAGCTGATCGTCCGAGCCCGAGGCCAAGTAGCGGCCGTGGCCAGCCCAGCGCACGCAGTTGACGGCCTGTTGGTGAttcgccag
cgtcgccagcagctcgaatgTGGCAATGCCTCCCTCctgcggcgtctgcagcgaccaAATCTTGACTGTGTTGTCCCCTCCTGCGGTTGCAAACAGCTGC
AGTGTTGGGTGCGCGTCCACGCCGTAGATGGCGCAGACTAGAGAACATCATCACCAATGTTTAGACGATTAGAACTCAGCATTGGGGGCGAGCGCGAGCA
CCGCGACTTGTGGATCGGCTGCGTATGCATATTGGGAGTAGGGACCACACGCACCGGTACCGGATGAATTCTCGTGCTTGACGTCCTCaggcttctccag
cagcatgtcgccTGCGCTCCGTGCTGCTACGGCACAATTACTTGTAGTCGGCTAAGTGCGAGTCTAAAATCTAAAATATGTAGCCATTAGATggctgttg
aagttgtaagTGAGCTATCTCGACAATAGCAATGCTCCACACTACGAGACGCTGCGCGCTCCTTGccctcttgctgctgtcgcggGTGTGCCTGGCGCCA
GCTGTCACCAGGAACGAGCGCGGtgcgctgaagctgctgtactGGACCACACACGGCCAGCGCTGGTCAGGTCAATGGGACACTCAGAACGAGCAGAGCG
ACCCGTGTCTCGACAATGCAAGTCggcttgcttgcttgtgTGTCTGCAGTGCCTTGGGCTTCAGTCTTATAAACTGTATTGTATTGTTCTAGTGGTACGG
CATCGTGTGCGACCGCAACGGCCGCATCCGGTCAATGTGAGTGGACTTGGAACGGGTGGAGGCTGCTACAGAAACTAACGTGTTACTTGGCACCACCTTG
CAATATTGCAGCCGCCTCGCCAATAACAACCTTGTCGGGGTTCTACCACCAGAGTTCCCACGCAAAGACCTCAGCGGTCTGCAAGAGCTGTGAGTTTTTC
ATTCTGAAATTTACTCTTGAAAGCGAAATCCCCGACTTGTGTTGTTTGTGTGCGCAGAGATCTCAGCTCCAATTTCTTGACAGGCTACGTACCAGACACA
CTGTCGCAGCTTACTGCACTGCGCACTCTGCGTCTTGACCGTAACAATTTCGTAGGTGCCGTCCCAGCGTCACTGGCGAAATTGACCAACCTTGAGTTTC
TGTGAGTCGAGCTAGCAGCAAGGCAGGTGGTTGACGTGTGTTTGTCGTGCTGACTATTCGTACGATGATGTGAGCTATCTACAGGGAG