Description :
From Genome Similarity Track
Location :
scaffold_21:6445- 55025
Transcript NameFunction/comments
g1132.t1 hypothetical protein PHYSODRAFT_337270
g1133.t1 AlNc14C182G8248
g1134.t1 hypothetical protein PHYSODRAFT_258132
g1135.t1 protein pelota
g1136.t1hypothetical protein
g1137.t1 dynein light chain/pantothenate kinase
g1138.t1 notchless family protein
g1139.t1 hypothetical protein PITG_04723
g1140.t1hypothetical protein
g1141.t1 mitochondrial-processing peptidase subunit alpha, putative
g1142.t1 hypothetical protein PHYSODRAFT_342126
g1143.t1hypothetical protein
g1144.t1 conserved hypothetical protein
g1145.t1 hypothetical protein PHYSODRAFT_532525
g1146.t1 hypothetical protein PHYSODRAFT_362533
g1147.t1 hypothetical protein PHYSODRAFT_532795
g1148.t1hypothetical protein

Sequence
48580 bases(100 bases per row)
TTGGTTCCGTGGCGACAGGAGTGAACCCCTCCGGGTTCAGCAGTGAGCGACTGGCACTGCGAAGCCGCTGTACATGCACCGCGTTGCGTAGGCGCTACAA
ACTGGTCAATACAATTGCATTTGTCGTCACACTTGACGAATTCCGGTGGTCCAATCATATTTCACGTTGTCATCGTGAGTGACCCAAAGTGTAACAAGAT
CAAAAAGACCACATTGCCCCAGCCAAACATGCTGCTTTTCATTGTATTCTTGCTTCTTGTGACGCGTGACAAATATATATCGCGAGCGCACTGCTCCAAC
AAATGCCCTTACACGTTTTCGATGTGCTTGAAACCCCCGGCGCTGTTTTCCAGATCAGCGTTCAGTCCTGCAGCCTCCACCATGCCAGTGGCGGTGGGTC
CCGATCGAAACCACTCAAGCGCGTACTCTTTGTTCTTCTGGAAGCACAAAAACGCCTCTACCATAGCCGGGTGTTCGGCCAGCGCAGTCTCGCGACCAAT
GCCTTCAGTGCGCAGAAGTACACCATACACGTTGCTTCGGACAGTTTCGCCGCTTGACGAAGCCGCCGGAATCGACAAAATCATCTCAGCATACGGTGCG
ATCAGCGGGAAGCGAAGCTGGTTTGTTTTCCACCAGGAGAGTGGATCGACGTTGCGTTCCGCTACAGGAAGACTTAGAAAAGCGCTCAGCTCCTTCTCCC
AAGTGGCGACCATCTCGTTCGCACCCTGAAGAGACGACTTGGATGATTCTGACGGAAGGTGCGAAAGCAGATCGTCATCCTCATCGTCAGCAAGACTAGC
ATCGTTGGCCGTCGGGCTCGTGGAGTCTTTATCCAGCTCAGCATAAGCGGATGCTGCAATTCTAGCGACAGAGTCCGCACCAGATTCCGAGAGCCCCGCG
GAACTGGAGGCATTCGATGTTTGCATCGAATCACCGTCAGTAAACATCCGACGAAGAAAATCTTGGCCGACGTCACAATCGGTCTTGGAGGCCAAATAAC
AGTATTCTCGGTTCTTGTAGCGAGGGTCAAACAGCGTCGCAGCGTAACAGACTGGAGGCAACGTTGCGAACTGACTACGCAGTTTGCGTGCTAGCATCTC
GAAGAAACGTTTCCACGATGTGGGATCCAAATGGGCCGGAATGCCCTCAGCCGCTGACTGCGCTTGCTTCTCCGCGTACGTAACCAAAGCCGCAGCGATG
GTTGAGATACTCGAAATGCCATTCTTGTACACCTCTTTGTCGCTGCCTGTCTTCTTGTTCTTTTCACCCTGGAGTGCCTCGGAATACCGGGCGAATGCCC
GCAACTTCTTCACTAGCAGGCTAATGGACTCAACCGCCGACGCAGGCGGATAAGCCACGACGTTTGCGGCTGCGATCTGATTCAGTGTAGGCAAGTGATC
CTGAAAGTCACGAAGGAACTCGAAGTATGACGCTGTCTCGCGATTTTCCGATGAAAGCTCAATGTCGAAGAGCGGGCACTTACGGCTAATGGAAAGCATT
GCGCTGTCGTTATTTTTCAGGCGAGCCACAAAGTCCTCGATCTGGCTGATCATTTCCGGGAATGCCTTCTCAAAAACATCTCGAGTCAAGCAGACACGCA
GGTGCTGCACCGCTGACGTCAGTAGGAACGTACTCTGTGCCGCGTCGGGCGAGGCAACCCGCCCATCGAAATTAACGGGGACGAAAAGTGACGGGACATC
GGAGGCTGTCAAATCGCTCTTCGCAGGGAGTTCATCCTTGATGCAAGCAATCACCTTGTCCTTGATGCCCAGTCGTTCCAGGTACGAGTCAAGGATAGCC
TTTACCGTCTCCACTCCAGCGGATTCCTCGAGCGGAGCAGCACCCACTGCAATGTCGAAGAGTCTGAAGTTTACACTGAAGTGGATCTTCACAGCCAGGT
ACTGGGTCGGCTTGCGTTCCGTCGGACTTGGATGTTGCCACAGCTCCAGCGACACGGCCACACTCTTGGCTCTAGCTAGGACCATCTTTGTGGTCAGGAA
CACGCTCTCCTGCAGCAAGAGGATGCTTTTACCGATGATATCTTCACTGGGCAGTGGCAGCTTCTTGTCTCCGAGTAGCTGGTTCATGACGTAATTAATC
CCCGGCTTGGAAGCAAAGTTCAGCGGTAAATTATCCATCAGGGCCATCAGAGCCAGGTCCTGGGTGAATTGGTCTGCATTAACCTGCACAGGCTGCACGC
CGTAAGGAGACCCAAGAGTTTCTTTCTGCTCTTTGGTCATGGCCAGAGCCGACGACGGGAACGCGTAGTAGGCAGCCGTTGGATCCCTCTTAAGTGCGGC
TGTGAATACTCCTGGAGAGCCTCCAGCCGCAGCCACAGCTGCCGCCAGAGCTTGGGAAGCTCCAGGAGGCGGGTACATGGCTGCAGCCACAAGTTCTCCC
GCTTGACCGGCCGCAACGGCCTGTAAGCCGAGCTTCTGGCGCTTCAAGTGGCGTTTGGTCTCTCTGTGCTCCTCGCACACATTGTTGGCCTGCTGGTGCG
TCGGGTCTGTGCGTCCAGCCGTGCGCAGATGCGAGAGCAGGTTGGACGAGTGGTGGCCCTTGATCACGCGCTCGCAGAACTTGCAGACGGAGTTGCCCGC
GTTGTCCTTCTCGAAGTACGACCACACAGCCGAGACGCTGGCCGGGCCGTTCGCGAGCGGAGTCGCTTGTCCTGCAGGCGTGGAAGGCGCCGACGACGCG
GCGGACGAAGCAGGCAGGAATTCCGCACTGGCGGCTACGCGCTTCACCATGTTATCGACACAGAAAACCGGTATGCACGGTACTGGTAATGGGGGAGAAT
GGGCGGGAGTGTGGCGCAAAGGCCGTTTAGATACAAAATCAGATGTCTCCCAGAACGTGTCACCCCTCCAAAAAAGCAATTGAATTTTAACCAATCACAA
GAGTTAAAGTCAACATTGAAGTCAAGGGTATGGTATCCGAAGCTTGCTGCGATCGACCGCAGTAGTTGACAAGTATTTCTCCATTGCTGTGCTTGGAGGC
AACCAGATTCGGCTATGTTGGGTCTAATTCGTCTCCGTGCGCTTGCATCGATCGGGCGTCGAAGCTTCTCGGGTTGGAACTGCATTTTACGTCACATTTC
CACGGTCTTTTGCTCATTCTGACGTGTGTACGCAGCTTCCAGCGACGCGACGTCTACTGTCGGCTTCATCGGTCTAGGAAACATGGGGTTCCCCATGGCA
CACAATCTGCTGAAGGCGGGGGTCGACGTGCTGTGCTTCGATGCGAACCGCACCAACGTCGACCGCCTTGTGCTGCTCGGAGCGAAGCCTGCGACTTCTG
TCGAGCAGGTCGCTGCTCAGACGAACACCGTCTTCTCCGTACTGCCGAAGGACGAAGTTGTTGTGAGTGTTGTGCTTGGAGACGAAGCGAAGCCTGGATC
AGGTGTGCTGGCCAACATGCGTCCCGGAGCGTTGCATGTTGGCTGCTCAACCATTCACCCAAACACGTCGCGTTCTCTTGATGCTAAACACCGAAAAGCG
AAGACGAAATACGTTGCAGCGCCGATCTTTGCGCGGCCTGACGGCATGGAGGCTATGCAAGCGAACTTTGTAGTGTCCGGCTCAGACACTTCCGCAGTGG
AGCAGGCATCTCAATGGCTGCACAAGTGCACGAGTGGCCGAGTGGCTCCGTTCAGCACGGAGGATTCAGGCGCAGCGAACGCGGTCAAGCTCTGCGGGAA
CTTCCTCATTGCTACAGCTATTGAATCAATGGCGGAGGCGCTGTCGCTGCTTGAAGCCAATGGTGTTGACCGAGTGCAGGCAATGCAGTTCTACAGCAGC
ACCTTCATGAACTCGGTGATCCATAAAGGGTACGGCCAACGCGTGTCTGAGCGAGACCATCGTCCTGGAGGTTTCGCACTGGAGCTGGGCTACAAGGACC
AGCGTTTGGCTCACCAATTGGCCATGGAGTCTCAAGTACCGATGCCGTTCTTGTCTACACTGATCGACCGCTTCCTGAGTGAACGTGCTAAGGGCCGCAG
CGACCTCGACTGGTCAGCCATTGGCCTTGGTGTCTGCGAATCTCGTGGCGTCGATGTTTCTGAAGCTATTGATCGGTCTCGCGCAGGACAGGCGCCACCT
CCACACCGACCGTAAGCACAAAGTCGATGGGATTACCACCGTGTTTTGATCGTTGAAGAACTTTCGCATCGTATTTTGAACTTTGTCGCTCAAAGTTATA
ACAACATTCATTCAACATTCATCTTTGTGAGCCAAAAAACTTTTTTTTTTGCATCGCGCGGTCAACATGAAGCTGCTCAAGAAGCAGATCAACGAGAAGG
ATGGCGCTGGATCGGTGGTGCTGCGTGCAGAGGAGCCTGAGGACATGTGGCACGTCTACAACCTCATCCACGTGTCTGACTCGGTCAAGACTACGACGAT
TCGCAAGGTGTGCAGCGCTTTATCCTGCAGAGTTACTACGTTGATGAACTCGTACTTAACGGAATACTGTCATGTTGCGGCATTTTAGGTGGTGAAGGAG
GGTGTAACTGGTTCAACCAGCAGCCAACGTGTCCGCATGACACTGCAGATTGAGGTAAGGCTACGATTTATGGTGGGAAGTGCTGCTTCAAGTTGACAAA
CCATACATTTGGCGCTATCCGTAGGTTGAGCAGGTCAATTTCGATCCGGCACTGTGTGTGCTGCGTATCAAGGGCAAGAACGTTATGGAGAGTCAATACG
TTCGGGTATGTAATAACGGTGTACCGCATTAGCAGTGGAAGTATATGGGATGCCTAATGTTGCCTGTGTATGCAGTTGGGAGCTTACCACACGTTGGATC
TTGAGATGAACCGCGACTTCACATTGACGAAGAACTGCTGGGATGTCATGTCGCTGGAGCGTATCGATATGGCGTGTGATATCGCCAAGCAGGCTGAGTT
GGCAGCTGTGGTCATGCAGGTCGGACTGGCGCACTTGTGCTTAATCAAGGGCGACATGACTGTCATTCGCGCCAAGATCGAGACGAGTGTGCCTAAGAAA
CGACCGGGGAACTCGGCTCACGCCAAGGGCACAGAGAAGTTTTACGAGAACGTTGTGCGCTCGATTCGCCAGCACATTGATTTCAAGCTTGTCAAGTGCG
TGTTGCTTGCGAGTCCGGGTTTTGTCAAGGACGATTTTTTCAAGTTCATGATTGAGCAGGCTGTCCGCCAGGACGACAGGCTTATCCTTGAGAACAGGCC
CAAGTTCGTGTTGTGCCATTCGTCGTCAGGCCACAAGCATGCCCTCGATGAAGTGCTTAGCGACCCGGTAATCCAGTCGCAGGTGGCGGACACAAAGGCC
GTTGAAGATGTCAAGTGTCTGGAGCGCTTCTTCAACATGCTGCATATCGACCAGGATCGTGCGTACTACAGCTACAAGCACGTTGTGCGTGCTAACGAGA
ATATGGCGATTGAGACACTTATGATCACGGACGCTCTTTTCCGGTCGCAGGATGTTGCCACTCGCCGCAAGTACGTTGACCTGGTGGAAAGCGTTCGGGA
TAACGGCGGCACTGTGCGGCTGTTCAGCAGTCTGCACGTGTCGGGCGAAAAGCTCGGTCAGGTGAGCGGTATCGCCGCCATTCTGCGTTTTCCTATGCCC
GAAATCGACGAAGAAGACCAGGGCGAGGAGTCTGAATCCGAGGAGGAAGAAGACAAGGAGGGCGAAAGCGGGGTTGGCGACCTGTCTGTCGAAGCTTTGG
GTATGTAGAGAGGATGCTTTTGTCAGGAGATAAATGCTTACAAATGCACGAAGCAAAGAGGCAACACTATTCCACCTTAGCTGCTTGTGTTATGCTGAAC
GACGAGGTTGGACACGCGCTTGTCAAACGTCTGCGACGTGAGCCGCTCGCCTAACGGTGCGAATGGATTCGACATGGCGTTCACATACAGCCGATGCACC
TCAGAGAAAAACTGCAGTCAACAGACACAGCAATAAGTCAATACCTAGTACTACTAGTAGCAGCTCGTCAAAGCTGTAATGCTCCTACCGGTCTCAGTTC
AGATTCACGGATGGGTGCGTCCTGCAGCACCACGACGAACTTGACGGATGTATTGGTCACGTAGCCGTAGACTCGGTAGTCCTCGATGGGGCCCAGAAAA
CCCAGATACATGTCGTCCTTGGACGTGGTCATGCCTGCGCCGCGTAGCTTCTCCTCTATCACGTCCAGAGACACATGCGCAATGTAATGGAACCCTAAGT
CTTCTCCTTCTTCACCGAACGTGCGGATATACAGGGGGCTATTCTGCACAGTAGTAATAGAGGTTTACGTTAGTGCTGATAGTCAAGCACAGAGAGATAC
GAGGACGCTGTAGCGTAGGTAGAGAGACAGCAAGCACTTACAGCCGCGCCGATGACGGCGACGCAGGCGATCATGGGCGAAAATGAAGAAATGTTGTGGG
AAGGTTGCTTGAAAGAATGATGGTCAATTCTGTTGAAGTTACAGTTGAAAGCTCACCATGTCGGGTCGTCGTCGTCTGCCGCGTCCGAGTCGCGTGCAGT
GGACGGTGGCGTGTATTCTGGAGTGGCATCGTCTTCATACTCACGTGCAGAGCTCGGATTATTCACCTCGCTGGGATACGCGGCTGGAGCTTCCGTTCCA
TCGTCGTAATTACTGGAAGACTCGGCAGGTGTCTCCTTTTCCGCATTGACATCCTCTGTAAGAGCGTATTCGAGCTGTCTGGGTTTGGATCGCGGAGTTG
AAGCGTCCTCGTCTTCTTGGACTAATTCAGAGGTAGTAACGACTGTACACGTGTCTTGCGGCTCGCTAGCATCTCCAGTGTGAGGATCCAGATTCCAGAC
ACTGTTTGAGTTGTCTTCTCCCTCGCTATCACATTTTGATACCGGCTCTGTTACGCTTGGAGCTAGATTCCAAACAGTATTCGTATCTGGTCCATTGTCG
ATATCGTCATGATCTGCCTGTGTTTGGTCATTTTCAGCGCCAGAAGACAGCTCACCGCCACTCGTGTCGGTGTGTACAGGAATATCTACGCTTTGCCCCT
CGTCAGGGTTACTGCTTGGGGGAGTTGACGGTTTAGGCTCCAAATTCCAGGGGTTGGCGCCATTTTCTGTGTTTGAGCTCGGGTTAGCAGCAACCGGGTT
AGGATCCTCCCCACTGCTCGAGTCTGCATCGACGATTTCTTTCGCAGCACTTGCAACAGCTTCTGGTGTAACCTCGTCGTTAGCGTCATCGTGTGTGTTT
TGCACCTCATAACTTGAGGTTGCATCAGGTACAGCAGGTACAGGTACATCAGGATTTAGATTCCAAACTGGCTGATTCACCTCTACAGTGCTGTTTTCTG
TTGTGTTTGTAGGCGCGTGGTGTTCATATGAGGTTGGCATTGGATCAACATTCCAAACTTCTTTGTGATCATTGTCATCATCGCCATTTGAGTCTTCTTG
CACCGAATCCGCTTCCGCTTCATGTGAAACTACTGGGTCTTCGGACTTTTCTTCCGTATGAAGGGGTAAATTCCACACGTTGCTTGCACTGTTGTCATCG
CTTGACACTGAGTTATTCTGCTCTTCTGCAGCTTCGTGGTCGTCGTCTTCATCGTCACTATATACAACCGGTGCATCGTCCACTGGAGTATCTGGGTCAC
CTGGGTTGGGATCTGCATTCCAAATTACCCTATCTGGACCTCCTTCACCTGACGGTTCTGGATTGACATTCCAGGCTGCAGATTTCATGTTGCTTTCACC
ATTATCCTGGGCTGATTGGTTCATATCAACACCATTCCTTTCAGGATCCACATTCCAAACGGCACCGGGGTCTGTTTCCTTGACGTTGTCATTTGTAGCG
CCACTATTCTCTTTCTGGTAAGGGTCAGGATCGTTGTGTGGATTTGAATCCACATTCCAAATGCTACCGGGGTCTGTCTCCTTAAAGTTGTCATTTGTAG
CGCCACTATTCTCTTTCTGGTAAGGTTCAGGATCGTTGTGTGGCTTTGGATCCACATTCCAAATGCTACTGGGGCTTGTCTCCTTAAAGTTGTCATCTGT
AGCACCACCGTTCACTTTCTGGTAAGGCTCAGGATTGTAGTGTGGCTTTGGATTCGCGTTCCAAACGCTGCCATAACCTGTTTCCTTACAGTGGTCATCT
GAAATGCCGTCGTTCTCATCAAATTTGGCATCTTCGTACGTCTTTTTCTCGCTTCGCACCTCCATGTTTGCTTCTTCACACCCAGGCGTATTTGTCGCTG
GTTCCTCTGACACGTGCTCCTCGACAGTCTCCAGTTTCTCAGGGAGTTCATCTGCTTTGTCAACGCCCGTGACTTCTCTGTCTTTTGCGTCAGCACGCTC
TACGTCTTCCTCATCCAGATCATTGTTTCTTGACGTGGATCGCTGAGTTCTTGCACTATTGATGATGAAATCCGTCTGTCGTTCTTGAAGCTCAGTGGCT
TCGAGTCGCTGAACCTCCCGAGCAGCTCGAATATGCAAATTTTCCTCCAATTCGCATTCGACTTCTAGCTGAGCTAGACGCACTTGCTTATAATATTCGG
CTTCGAGTGCTCTTCGACGTGTTTTAGAAACAAACCCCTCTCGGTAGTCGTATTTCGCTAGCGGTACGACACGGACTTGGCCTGTAGCACTCTGAGTGGA
GTTCATTGTGGGAATTCTCTCGTTTTGTCTGCTGTCTGGACTCACTTGCTCTTGTAAATTCAATGGCTCCAGCTTGGTTTTCTTCAAAAGGGTGCCCGTA
TAAACGTTTGTGGTCAAAGGCATAGCTGAAACTTTTAGTTTGCCAGCAATTGCAGTGGGTGAAGCTGCCGCTGTAGTCTCTAACTTTGCTCGAAGGCGAT
CGATCTCTGAATGACATTCTTCAATCTCAATCTCGAGCTCCTGGAATCGAAGAAATTTGCTACATACGCGTGAGTGAGCAACACACCGAGTGCATTGTGG
GAATTCGTGTCTTACCTGCTGTACTTTAGGCGGTCAAGCTCTCTCCTTCGCTCTTCTGCCAGTGCTTCAGAAGTCGCAGCCTATCTAACCAAAGGGGAAA
AAGGGGGTCACTACCAGTATTTTTTCATTTCAGTCTATTCGTTCCGAACAGCATTGTCATTACCCTCTGCATACACTCGGAAACGAGGCGGTCAACAAGC
TCCTGTTTGCGTGTTTTGGTGATCTTGGCGTCTTGTGGAGATCGTAAGATAGCAAACGCAGTTTGCAGCTACAACACAGTAAGCATTGCGTTAGGTTCCC
GTGTCGACTGTCTAAAAACGTTTACCTCGTACATCTTTATCTTTCTTTCGCAATGTTTCCTGTAACCTTCGAGATGCAGTTTTCAGCTGTAGAATCAATG
CATCCTACACGTACAAGGACATATTAGTTGCCTTGTAGGGATCAGCCATTCATTCTTCTATTACACCTTCTCTGTGAGTTGTCGCTTCACCAATACAAGC
TCCTGCTTGGTATTTTCCCACTCTCTCCACCCATCGTCCAGCTACAGCAACGTTAAAAGGTAAGACTGACTATTCTCCAAAACAAGTTTGCGTCAATTCT
GCACCTCAAGCCGCTGGTACGGCGTCACTTGCGGCTGACTGGCGCTGTTGCCACGCCGGCTCATTAGCCGCCTCGCCATCGTAGAGTGACGCACGTTCAA
AATATTCGTTTCGCGTCCCAAAATGATAGAAGGCCGACCGGAAACGTCGCGATCTCATCGATACTAGCGGTCACTAGGCGGACGACTATGGGGGAGGCAC
CGAATTGGCAGTACATGTGGGGCGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGACGTGCTGGAAGACGCCATCAAGCACGTGACGTCGAGACTGTC
CAAGTTTGACACTGAGGAGTGGGAGAAGAACGGACTGGCAGTGAGTGCAGCGTTGATGCGTACCATCCCCAAAGCGATGGTAGTTAATGTTGTCCTTGTA
TTGCTTCGCCTGGACTGGCAGGTGTGTGAAGAGATCAAGGCTCATCTGGACGACGCGTGGGATCCCCATTGGGTTGTGTGCATCGGCAGGAATTTTGGCT
CGTTCGTGACGCATGTGACGAGAAACTTCGTCTTCTTCTACTACAACGAGAAAGCAGTGATGATCTACAAGGCAGGATGAGGAGAGAACGCTGCAGACAT
CGAGAGTTTGCTTGATTCCGTGCACCAATTGTTTTTAGTTCATACAGCTACAGACATCACCAAAATGTCACTTCAAGTACAGCATGCCAATTTGAGTCCG
ATGCAAACTTCAAATGAATTTTGACGGTTTGGTTCGATGTCCCGGCTATGAAAGTTATCTTTCCAGACTAAATCACAATAGGGCCACTTACAAACTTCGA
ATCAACCCCCTGTCCCAAGCAGCCCCGGCTGTGTCCAAAAGCCGACCAATCAGCGACGTCTTCATTCTGATTGGCTGATGAAAGGTAAATTTCGCATTAA
CGCGGCAGCCAACAGTTTTTGACACATTCGCATTAGAAGCCATGGCAACGCACGTCGCCAAGAAGATGAAGGTGGAGCACGAGCCCATCAGCTCCAGCGT
CACTGACGCCGACGCGTCAATGAAGCAGGAACCGAATGCCAGTGACGATGAAGAAGACTCCGAAGATGAGACCGGGACGTCTGCTATCGCCCAGTTCCAG
AGCGAAGACGTGAGTGGATTGACACATTGACACAAATTAGCCCTAGGGATGCTAATATCGTCGCTTATTTTGCGTATTTCAGGGCACTAGTGTGGGACCA
CAGCTTGAGATCCCGCTGAGCTCCAATGTCCGCCAGATGGAGGAATTGGTCAACGAGCTGCTGCAGAATGGCAAGAACCGCGTCCCATACTCGCTGTTTG
TTGGAGAGACGGAGGTGACGACGTCACTAAAGGCCACGGTGGAGGAACTGGTTCGTATTTAAAATCGTTACGAGGTGTTTTGTTGAAATTCTGACGTTGT
TCTTGATATTATTGTACAGAAATTGTCGACGGAAACGGCATTGACCATCACGTTCCAGCCGCTGGCAGCATTCCGTGTGCGTCCGGTCACCCGCTGTAGT
GACACATTGCAAGGACACTCCGAGGCTATTTTGCATGTGAGCTTCAGTCCGGACGGGAAGAGATTGGCGAGTGGAGGAGGTGACGCCACTGTCCGCTTCT
GGGACACCAACACGTGCATGCCCAAACACACAGGTCGCGGACACAAGAACCACGTGCTTTGTACTGCATGGTCGCCCGATGGAGCGCGCTTTGCGTCGGC
GGACCGCAACGGTGAGATCCGTCTGTGGGATCCGCTGACGGGTAAACAGATCGGCCAGCCCATGAAAGGCCACAAGCAGTGGGTGAACTCTTTGACCTGG
GAGCCCATGCACCGAAACGCTACTTGCGAGCGTTTTGCTAGCTCTTCCAAGGATGGATCGATCAAGGTGTGGAACGCTCGTACAGGCCGATCTATCGCCT
CATTGTCGGGCCACACGGACTCGGTGGAGTGCATCAAGTGGGGAGGTGAAGGCTTGTTGTACAGTGCGTCCCGTGACCGTACAATTAAAGTTTGGGCGAT
GGAGGGCGAGCATGTGGGAAAGCTTGTGCGCACACTGATTGGACACGGTCACCGCATCAATACTTTGGCGTTGAACGTGGACTACGTGTGTCGCTCGGGT
CCGTTCAGTCACAACACCAAGAGTTTCGCGTCCCGGGAGGAGATGCAGCAGGCGGCGCTGAAACGGTACCAGGAAGTGCGTAAGGGCCAGCCGGAGCGCT
TGGTTTCCGGCTCGGATGACTTCACGCTGTTCTTCTGGGAGCCTTCGGAGAGCAAGAAACCCCTGGCACGTCTTACGGGCCACCAACAGCCTGTGAACCA
CTTGAGCTTCTCGCCCGACGGACGTTACTTCGCTAGTGCCAGCTTTGACAAGAAGGTCAAGATCTGGAACGGTCAGAATGGAAAGTTCATTGCCACGCTC
ACGGGCCACGTCGGTGCTGTGTACCAGGTTTGCTGGTCCAGTGATTCTCGACTGATCGTTACGGCCAGCAAGGACTCGACCGTGAAGGTGTGGGAGCTGA
GCGAGCCGAAGAATGCCAAGACGACGCTGTCGGGCCATGCCGATGAAGTGTACGCGCTGGATTGGAGCCCGAACGGCGACATGGTGGCCTCAGGCAGCAA
GGACCGCACCATCAAGATGTACGTGAGCTCTATTGCCATTGTTGAAGTTGTCCGGTCACTAATTTTCCCTCGTTTCTGTGTCTCAGTTGGAAGCACTAAG
CCAAAAAATAGACTTGTTTTTTGTAAGGTGCTGGAAGAGATGTCATTTCGTACTTAACTGAGTAGGCGCCAAACTCTTCCCGCCGAGCGTCCTCACTTCC
GCTTTTTCGCGCGCTGCCAGCAGCTCAGTTTTGCCGAGTTTGATTCGCTGTTTTTACTATTAAAACCAGTCCCCTGCAAAATGAAGCGCTCACGCGACGA
GAGCAACATGGAGGACTGCGACATGGACGCCGTTGGTATGACGCCGCCACCTTCGTCTCTTTGGGCGTCCATGTCCCCCTGGAAGCCGCCGCACTCATCA
GCCAAGCGCTGCAGAGACCGCTCTGTACCTGTTGGTGCGTGTTTTTCCTCTCGTTTAAACTTGTGTTTTAGCTCCGAAACTCACTGTCTAAATGCTTTTA
CTTGACATGCAGACGCGCTAAGCCGCATGATGTCCGCTGCCGTCACCAACGCACGCATCAAGAAGCACAGCAGCATCGGACGGCTGTTCGGAGGCAAGAG
CGAGCCTTTAACTGCCCGCTGCGGCGTGTGCGAGAGTCCCAAGTGCCAATTCGTGGCCTGCCAGATGCAGCGCTGCAGCCACTGCGAGCGTGCAATGGGC
GACTGCTGCCGCCGCGAGTGTGACGCGTGCAGCCACGTCTTCTGCTCTTCGTGCTCGACGCTCAACTGCGACGAACAGTTCGACCGCGTCTTCTGTCTGT
CGTGCAACGAGGAACAGCAGTGTCGGGGCTAGAGGCTGAGTCGGGAGGATTTAATTAGTAATTCTAAGTGTGTGTTTCAACTGTACTGCAGGCCTTTGTG
GACTAACTGAACATGTTGGAGCCTGGGCTGTCGTACAGGAAGCTGCGGACCATCTCGTACGCGATGGCTGGTTGATCATGAGGAACCATCTAAGCAGAGA
CGGATTAGTGACAAGATCAAAGGAACAAAGCAACAGGGACACGTACGTGGCCAGCGTTGAAGACTCGAATGAAACTGAGGCCGTGAGAAGTGCGTACTTG
GCCGATACTTCTGCCATGGAAGGTTTGCTCGGTGAAGGAGGCAGATCTGAAGGCTTCCTGGTGCATCCAAGAGAGATCACGCGTCCAGGAATCCTGGGAC
ATCCAATTGACGACGGTGTCGGCGTCACCTCCGTAGACAAGCACCCGAACGCCGTGCTCTAGCGCTTGAACGACATTCGCCTCGCTCTCTTCTAGCTGGT
CCATTGCTGCCAGTCGCTGAAGTGCTCCGGATGAGCACAGCCTCCATTTGTGTGGAGCTTCGTCGAAGTATGCTGTTGCTGCTGGGGTGTTGACAAACGT
CTCGAGACGGGAAAATCGGTAACACAGCTGGAGGGCGTCGTCCTGATGGCATTCGCGACGTACGTCGTACACGTTTCGACCAAGATTCAAGACAGCGGAG
GCAGTACCTCCTTCAATATTGATGAGGCTTTGCAGAGCCGTATCGCAGTCAGGGTTGATACTGTCAGGATGGCGCAAATTGCCGCCTCTCATGCAGTTTG
CGATCGCCGACTCGAAGCGATCGCTTAGTACGCGAAATCCCTCTTCATTTGAGCCAAGGAAATCGTATCCGTACGCGCTGGACTGGAAGAATGGGAGCAC
CGACGTAGCCCATGCAGTAGTCGACACTACACCATTGCCAATCGCGATTCCTTTCAGCGTCGGAAGTGAGCGGTCCTTGTCAAGCATTCTCACCGCCAAA
TCTGGTACGTAGTGGCCTGCGTAGCTCTCCCCGAATATGTAAAAATGGTTCGCTTTGAGCTCTGGATGCTGCAGGTAAAACTGCTGCAGGAACTCCTTCA
TGTCGTCCGCTGCAGTTCCGAGTGACCAAGGGTGTGTAACCCCGTTATCCCCGTCACTGTATCCTGTACCTTTAGGTTGGTCTAGATAAATAACGTGAGC
AAGTCCAGTCCACGAGTACGGGTTGAGCGAGATTGAGTCTGTCTCATCATCAAACGAACAAGGACCATTTTCGAACAGCAGCGCGACCAACCCAGAGCAC
CCAGGACCACCCGATAACCACAAAATTACCGGAACATCAGCTTTCACGGCGGAGGATTGATAGAACACGTAGAAGAGATTGTTGAGCGTGCCGGTCTCCT
TGGCAAGATTCTCTCCACACAGCGACGTTGATGTCGGATATTCCTCGACGAGGTCACTTGCTTGAGCAAGTAGCTGCTCCCCGTCTGAAAACACCCAACT
TTGCGCTACTAGCACCACCAAGAGCAAGCACCAAGCGCGAACCTGCATTTTCGATGACGAGTTGTACGCAAGATCGCGAATGACGAGTCACTAGTCGCAA
CATGCGACGGTTGCCGCGGATACCTCAAGATGTCGTATCGAAGACGGTTGAAGAAGACGTTACGGAAGTTTTGCTTACCGATTCAAAAGAAGATCGACTC
CATGAGGGGGACGAGATGCTCGTAAGCGGGGACTGCAACTTCTGGAATAGCGTACTTAGGGTTTCCCGATGGTATTTCCTCTGGTGATTGGAATCTGAGC
TCGTTCGAGTTACTCCACGGATCTTGAGCAACAGCTTGAGTTGGAACTCGGAATGCCATGAGTGGAAGTGGGTTCGTCTCCTGCTGCTGTCAACCATATC
AACGTTAAAACGGTTCGTGAGCCATGGTCCTATCCAGTCCAGGCAAACCTGAACAGAAGCCACCCCTTTGAACTCGTGCTCTTGCAAATTAAACTGCGGT
TCGCGCGTTGACGCTGGGAGTTGAGAAGATTTGGACTTTCCGTTTGAAACAGCGGAATGTTGGGGCGTCTTGCTGACAGCTTTCTCGCTTCTACCTGGAG
ATCTGGTCTTGTTGAACCTGAATCGATCAAACGAGTCAATAGCGACGACCTGCTTCTCACGCTTTGTCTTCTTCCGCTGCCTGTTTTTGAGTCGACTCTC
TTCATACGGACGCTTCGACTGCAGCCTCTTCCTTGGCCCAGTCCCCCCTCTCTGCACTCCGATCTCACTTTGTGCAATTGACTTAGTGTTATCCAGATTG
GGATTCCGTTTTTGGGATTTTCCCTTCGACAATAGCAGCACTGCCACATTATCCTTCGACACGGACGGCTTCAGCACATACTGGTGCTTATATCGTGCCG
CCTTCACGTTCTTGACCGAGTCGTCTGTCTGTCCGTACTTGAGTTTTTGCATGTACCGATCCATTCGCTGCTGCTTAGCGTTCGTTTGGTGGCTTGTCAG
CGTCTTGATGTAGCGAAGGATGCTGCTGTCTCCTCCCGTAAGATCTTCATCCCTCTGCATTGTGCTTGGGCCTCTTACAGTGTGCTGTAGCACTCTGCTC
TCGCTACAGAGTGATGGTCTTCAACTTCAAAAACGATTTTCCAGAATGAACAAATTTTGAAAAATAGTTGTTGAAGAAATAAAGAAGAGTGATGGTCATA
CTTCAAAATACAGCTTCAACTATCTGTTAAACCAGCGCTTCTTTTTGGACTTGTGTCGGCTGTAGACTGCAGCAGCTCGACGACCTCGTCGGGAAATGGT
CAGCGTAGTCAGCGACGAGTTTGGCGCTGCCGAGGATGGAGCCTTCCACGAGTCCAGCAACGAATACCGTCGCTCAGAGTTCATGTCGCTCATGCCGCTA
ATGCCGCTTTGACGGCTCAGATACGACGTCGTATCTGATGGGATCTCAGCCGTTGCTTGATTACGACGACGTGTAGTTGGCGCTTGTGAGATGAAGTTGC
TGATGTTGATGTTGCTCATAGGAATGTCACCAGCTGCAGTTGACGTTATCCTGTTACCGTTGACCATCTTAACGTCAACGTCGTCTGGTTTCAACGGCAA
GCTACCACGACGAGGTCGCGTCGCGAAGATGTCTTCATCGTCTTCGTGATCATCATACTCGGCTGCCTTTGTGGAATGATACTGCGAATCGATGGGCTCA
TATCGAGCCCCTAATGTCGAGTAGCGGACCGATGTGGGAGACGGCAGTGGGGAATTGCGAATATCTTCTCCCTTGTACCGAAAACTGCGAGGAGCAATAG
TTTCTGTCAACTCGACAGCTCCACCAGTAAAGTTGATACTCTTTGGAGGTGCTTGTATAAATGTGCCATCGATATCAACTTCACGATCGGGAGGAATACT
CTTGACATCGACCCGAATGGAAGGTTCTCGCTCTCCATCCACGTCAAAGCTCTCAACACTTGCAGGTATTCCTCGTGCTCCGTCCACGTCGAAACTCTGA
GTACTCATAATGTTTGGATCGGCTGATTCGATATTTGTAGTCCCTGTGCCCACAGGCGGCTGCGTTTCCGATTGACCAGTCTTAATCGAGTTACGGAGCA
TCGAAGGGCGGCTTTCCAGTGTGAAGTTGTGCCAGCGTCCCATAAAACTTCGCGATATCTGCTTCAAATGCGTTTCTTTCGGTTCTTCAGCATGAATGAT
ACGCAGGACACGATTCACGTTCGATAGGAGAGGGGCCTCGATCTGCTCCTTGTTTTCCACTAACCCTTCTAGGAAGGCCAGCATCTGAGGGTAGTACTTG
AGATCTTTCAACCAGTACTCGGGGTCATCTTTCGTCCCGTTCTCTGTCAGTGCCGTGCTACGAGCCTCCAATACACGACGAAGTACCTTCAGCAAGGACG
GAATATCGGGGTGCTGCATGGTGATTCGACAAATCAGCAGCTCCACGAATTCTTTCGAGGTGATCTCTGGGAACTGCACCAAACGCCGAGCAATCCGCAG
AATACAGCGGTACGGGAAGCTTGTGATCAAATTCTGGTTGCAATTGCGTACAAGCTTTACGATTTGATCGGGTATACGATTGTCAGCGATGGTTTCGTCG
ACATCAAGCGACGCCCTCAAAATGTGCGTCATAGCCATCGTATACCTGTCAATTTCATCGGCAACTGCTTTGAGATTGTCTGGAGGATTTTGTAGATCGA
AGCTCATCAGTTCGTCTAGCTGAGTTCTCCATAGCTGGAAAAGCAACTCCAAATTGTATGATGGATTTGTCAGCTTTTCCGGATCTGGTCGAGACAAGAA
CCGATCGATGTACAGACCCGCCACAAAGTTTTCGGGAGCCGGGATAAAATCTGTCTTATCATCGAGCAGAACAGAGTCTCGCTTGCCAAGCGATCGTTCT
GCTCGGTTTCGACAGATAATTTGGTCGAGCTTTTTACGTACTTCCGTTCGTCGGTGAGAATTCCAAATCAGGTCACTCTTTTGGTGGTTGTCATCAAAGA
ATCGCGAAGCCTTGTTCGGATCCAGGTGAATTTGGTACACGATCGGGTAGGGGAGAAAGCGACAGAGCCCACTGTACATCTTTTCTCGCAACTCCAAGTC
TTTCATCAGCAACGCGTACAAAACTTCAAATGCAGGTTCTCGCAGCGCCTCAGCTCGAAGGAAGTGCTCATGCAGAACGTGCTGTCTTGATTGGAGCGCG
ATACCCAGAATTTCAACCCATAAACCACAATCTTGCACGTACTCGGCAATGACTAGACAAGTGTCGCACAATTCGGCCAGGCATGACAGTGCGTAATATG
CTTGCTCGAAACCGAGATGATCCGTGATAACCTGAAGACACCACGTGAACTGGCAAAAAGGTTCCAGCATCCGTTCCAGGTTACACTCAAACCCACATAT
TTTGTTAAGGATAAGCAGTGCCATTTCTTGTCGAGCCAAATAGTCCACATTTCCAAACTCGGCTTCCATGGCAGTGGGGGCGTCGTCGGCTTCGGCCTTA
GCTTTAAATCCATACGTCGACAGCGACCGACGCGACGATATCGATACCCCCGCCTTTGTTTTGTCATCACCATCAAATGGCAGTAGGTATCTACCAAGTG
TAGCAACCGATATTGACGCGTTCACTGCATCCTCGTCATCAATATGTTGTTCCAAGCACTCCACAATGGCAGGTCGAAAGGCTGGCAAGTCGCACAGAAG
ACTTAAGCAGTCCAAAGCCGGCATTGTATCCGAATAAATCCCAAGTTTTGGGTCCCTGTTCTCGTTCAAAAAGCAGAAGAGAGATTCGATGAAGTCCACA
GCAGTAGTTGGGAACAGCGTATCCTCCGAAATCACGTGGGGTTTTTCCTCCGACTTCTCGAGCAAGATCAACAAGTAGATACCTCCAACGTACGGCTCCG
AGCTGAGGCAATCGTACATATAGTTGGTCGCACTTTCTAAAAACGATACTCCATCATCATTAGGGTCCGTGCAAAACTCTTCCGTCAGTTGAGATAGTTC
GTTCCGCGTACTCTCGTTCCAGATGCAGGTCGGTTCCCGAATATCCGACAATAAAATTGTACAGAAGTCATACCCGTTTGGCTTTTCCAGGCGATCCAAA
AAGTCCATCGGAAGGAGATTTGCTAGGGCTTCTAGTCCTGCAGATCGACTGTTGCCATCCGGCCCCAAAGCTAGCGATCGAAGAGCTCCAAAAGCACTTT
CCAACATATCCCGTTCCTGTTTCTCTAATGCAGTGGTACTTTCCTGGGTAGTATCAACCCCAGACGAGCTTTCAGCGGAAGCCAAGATCAAATAGAGACC
CTTCCAAAACACCCGTGTGGAAGTCATGATTTGCTGTTGCAGCTCGTGACTTCGACAAAGCGATGATGCAATCTCAAACGACATCTTCTGGATATGCCAC
GGTTGGATATTCTCGAACGAAAGAATGACATCATCCAGCAATGAGTACACGCGTTGCGCATACCTAGACTTTCCAGCTCCGTTTTGAGACGTGTATTCTG
TCGCAGTAAAAAATGACGTGTTGTCATCATCCCCGAAAGTGTTAAAGTCGAATGTCTTGGATGGCGGGATCGAATTCGAGCCATTTTTATCGTCTTCTAC
CCGTAGAAGCGATTGCACCCCTTCTTCCGAAGTAAGGATCAATTTTAGGATCGAAAACATGATCTCCTTTGCTGCTACGTCGTGGCCATACGCACAACTT
TCCACTAAGTCAAGAACGGCGTCCCAACTACCGTCGATCACAACAATAAGTGGACCATTTTGGGGCGCGACAGATAACAGTCGTTCCAACACTTGCATGG
CTAGGAATCGAACTTTAGCTTCCTTAGCTGTTCGAGAAGCCAACACGCGGACAAGAAGGTCAAGCGTCGAAGACTCGTACGAGAAAAACTGAAAACCGTA
CTTGTCCAGCAACTGCATCTGCGATTTCAAAATACGCTCGATAACATCATCCGATGATTTTCCGTCATCAGCCTCGTTCTTGCGCTCAAGTGCACTGCAC
AAAGAATCAAACGCTTGACGAACTGTTGCCAATTCAACTTGTTGCTGACATAACTCCCGATAGCGCGAACGCAAATCTGACGACGAAAACGTGATGTCTT
CGCTCCAGCCAAATAGTTTATACGCATGTGAATGATCCGTATCATCCTCCATTCCATCTGCCTTGCGACGTGCCAGGTATCGCCATTTCTCCTCGATACT
TTTCATCATAAAAACGGGATCTTCCACCTCCTCAACATCCGAATTAGACTGGTTAAAAGTCGAAAGATAGAAGCCACTGCAGTATACATCCCCAGACAAT
TCCAGATAGGAGATCGGAGGAATCGGAGTGTAGTTGTACTTCGCTGTGACGTTTGTCTTCAAGCATTCCTTGAAATCTCGTAGGTGCTCATCAATCATCT
CTTGCAAGTGTAACCTCATTGTCGACGACCACAAAACGCGTTTGTCACGCTTACGCCCACTATAGACTTCGGCAAATAGCTCAGGAGTTTCCGAGTCCAA
AAGTCCAATGAGTGATTCGGGCAGAATGTCAGTTAGATAGCTCTGACCCACATACCGATCCAGTGGCCGCTGGCTTCGATGGATTCGTTTTAGCAGTGTT
GCTTCTGGAACAAAAGCAAACTCCTTGTCGGCCCCTCCGAGACTTGCAGCCGCAGCCAAAATGAAAAAAAATGCTCCGTACGTATACAGCTCATCCAGTT
CTTCATCGTTTAAATACATCAGCATCTCGCAGACGTATCTCCGCACGTTTGAGTTGTTTACGAGAAGAAGCTGAACCAATAAAGCTAGTGACGATGTATT
AGCCACCACGATATTCACCAAAGGTGGAGGCCACAAATGTTTATTCCCGGCCGCTGCTTTGCGTTGATCTTTGATCATACAGTTCCTCAGCGACTTCAAT
GCGAACATGGCACAATTTGTGTCAATGGGTTCGTCTGTCAACTCCATCCAGCGCAGCTCTGGGTATTCAAACATCGATTTCCATACGTGCTCTTCACCGT
CAGAATGCGTCGAGCAGCAGCAAACATACAGAGCGTCGATCTGGCGGTGCCGAATGAAAGGGTCAGCATCTAAATATTCTTTCAGGTCGTTTGCTGAAAA
TGGACCTTTCAGAGTCGTTGTGTCATCTGCTTCCCCGACAGCTTTAAGCTTAATGCTCCACTTGAGTGAATATCTTGATTCTTCGTAGAAGGAAAGCTCG
GCAATGGGAACGGACGAGGTCTCATTCGCTTCGGACACGAATGAATCCATCATTGGTATATCGCCGAGATCGTTGGTCATGTCACTTCCCAGTAGAGCTA
CTTTGTATCTGTGTGAAAGCAAGGACATGTACAAGAGCACTTGAATGTGGCTCTTAGTACATAACTCGGCACAGGTATCTCCAGACAGACTTAATCCAGA
CAGCAACTCCACAATATCTTGGATTTCACTTGCCAAATACGAATTCCGTAATAGCTCTGTAAGAAAGCGAGCCCGGTGCTTGGTAATCGGTCGTGTTTCA
GGGAAAACATTGGCTAGCTCGATCAGGATCTTCAGCATTGAGTGACCATGCTGTTCACTTCCCGTTGCACCAGTAAATTGAGGAAAGCCATTGCTCCCAC
TTGCAGACCAATCACTCGTTCCAGATAACGGGATATTGTTCAAGTGAAGATGTTCCAACCAACACTGATACACCTCATTGAAAAACTTCGCTGGATCTTT
CGCAATATCCATGCTGGCGAAAAAGAGACTGCTCGAGTTTTTCAGCTTTCCTCGATGTGTTCCAGCTTCCATCGAGCGAACAGCTTTGGCAACTTCTGTC
AACTGCAACGATCCGTCACTAATTCTTTCTGTAATCACGCGTAAATAAAACCGATCAACTTGAAGCTCCTGGGCAATGCTTTCGTATCTCACCGAAAACT
GGGCGTGATTCCACTTGGGTTCACTGCTTGCTTTTCGAGAAGCCACCAACGATAATGCAACCACTTGGTTAGCTTTAAATTGCTCAAATTCATCAATCGC
CGAAGTGAGCGCGACTTTCAGTTCACCTCGCGTAACCTCGTTCCAAATCAAGTCTGGAAGCATAAAATCCTTGCTAACCATACTCGACAATAACGCCATG
TCTGTTGATGATTCACCAGGATAATTCAATCGCGAGGGGTCCTCTTTGACTCGAGCTTCTTTCACTGATCCACTAGCAAATAGTGTTCCAATCTGGAGTT
GCATGCGACGGATAAACCACGCTGATCCATCAACTTGGCTCTGTAATTGGTGCTTACTTTTCCGACGGGTAGACTCAGTTTGTCGAGCTCGCTGCTTTTT
CAACAGTTTTCTGACCATTGGGCTCGAAATCATCCGAATAAAGCCATGCGGGAGAATTCTTACTAGCATTTCATGGGAAGCCTTGTGATGAGTCACCCAT
ATGCTGGCAATGTATTGATACGTCTCCTTTGCATTGTCGGACGGGTGGAAAAACGCTTTGCGCAGGTGCTTGAGAGTTAGACCGGAATCTAAGGCAACGT
CGCAAATTCGTCTCCGTAATTTATGATCACCGTGGTCAACAATCACTTTTAAGACGCAGATGACAGCTGCAGCCAATCCCGCATTCAAGTTTTGAAATGC
TAGCTCCAGCAACAGTGTGTACTTCCCTCCAAGACCTTTCACGATGGCATCAAAGTGGTTGTTATCGGTACTGTGACGAGAAACCACCAGCACATCCAGG
ACCAATTGCAGCAGTACTAGCGTGGAGCATGAATTGCGTTGTTCCAGAAGGCCGGTTAATAGTGAAATAAGCTTACCATGCTCGAATACTTGAAAGCGAA
TAGCCTTCTCAGCTGCCCGATGGGCATTTGACCGCGATTTATCAGCAATAAGTGAGTGAAGCGCATTCACGGCCCAAAGAGTAGCAATCGAATCCCCAGA
TACCAATATCTGAGCAAGGGTAGGAATAAGTACCATGGCGCCACCATTTGACTGTTCCATCGCAAGCCGATAACAACCGTCATTGATCCGGCAAAGCGTT
TCGAGAATAACACAAATCTCGTTCGCACGAATAGGTGGCTTACAGGAATGTTCGAGCTGTCGAGAAGAATGTCAGAAAGAAGACGTCAGTTTTCACACCT
CAAATAGAATAGATTTATCTATCCATTTTTCTTACCATATTGTTGATCCCCCGAAGCAAAGAGTTGAAAGATAGTTTTTCCAATCGCCCACGCATCGACT
TCCCCGCAAAATCCTCGATCTCAACATTCATATTCAGGCTCTCCAGGGCAAAGGAAACTCTGTTTGTTGCGGATGTGATACTCACATCTTCACCACTCAT
CATTTCAATCTCTTTTTCAAGAGTAACATGTGCTGGAATGTAGAGGCCATCATGATTGAGATAGAGAAACCGTTCGTGTTCGTCCTTCAGCAGTGCTCGA
GGAGACATTCTCGGGTTCAAGTTGGAAAACTCTCGACTTAGCGATACATCGTAATTCTCGACGTAGCGGTATCCATCATACAGCGCTGCTAGAAACTTTT
CGATATCGTATGGCACGTAAACGACGCGGCTGCTATCCACAAACTCCAAGGCCACCACAGTTTGGGTATCGTCACTCTCCAATCCAGGAACCACTACACG
CCGCAAACTCCTTAGATCGTAAGACTTCTTTGAGCAATTGGTAAACTCTTCAATAGTTCCGTCAACGAAACACAGCTTCTTCTTCCGCAAGTGTGTGGAT
CCATGCCTGCCAGTGCGTCGCTGAACATCAAACAAATCGTTCGATTGAAATGCAGATTGGTCCAGAGGTCTTTCCGCTTGTTGCTTTGGTAGCTTGTCCC
GGATCTTGAATCGAAGATGAATTCCAATAACTCCAGCCAAGGCCTTCATTTTTTCTACGATGTCATTGCTTTGGTCGGAGTAAATGAATTTCAGTTTGTT
CTTCACTGTAAGGATGAACGCATCTGGGATCAAAGTCGCTTGAGTAACCTCTTCAATTGCGCGGAACTCAAATTCATGAGTATGTTTTGTCACGATTCTC
ACAGCGATCAGTGCTCGCGGAGTCAAATAATACTTGGTCTTTTCTCGCTGCCCATCCGCTGTCCCGATAAAGCCGCTAAAATGACTGCAATCAACGCTAT
ATACGCGCTTGAACTCGTCAAAATTACCCGCCAAATGACTCATAAGCTCCTGCAAGAAAATATTGCGACATCTGTAGCGAAGACGCAAGAAGACCGAGTC
GTCGTATTGATCAATCCCCATCTTCAATGAGCCACATGACGCCTCTAGAAATTGCCGATATTGCCGCAGAAGAACTTCCGGGTTCTGAACAACCACCACG
TTAGCTGGAAGGCTGGATCCACCACTAGAAGATGACTCCGACGACGAGAACGTGTTGTTTCGGCTGGATGCGTAGTTATTTCTCCTAGAAGAATACAACG
GGGGCCGAGATAGCGGAGCTACTGGTGCTCCACGTTGACTGCCTGGCCCAAAATTCAATGTTTCGCCAAAGCTGAGTGATTGCCGAGGTATTTTTCCATC
ATTGGATCGTAACGGAGATCCCATGTTACCAAAGTGCAGAAACGCTGGGTTTTTCGTCATTCTGCTAAGAATTCCCACGCATGCCTCCACGGTAGCCAAG
GCGGGAAAGCCAAAGAGAATTCGCAGCATCATTCGGTATTTTGTCGCCAAGTGTTGGTACAGCGTTTCTGATAGTTTCCGCTGCTTCTCGACATTTGCCT
TCACCAATAACAGAATAAACTGGCACAGCTTCATCGTGGGCAGATCCGATAAGAACGAACCAGTCTAGAATACACAAACAGCCGTGTAAGAGTGCAACCA
TGATATCAACAGTATTTTTTCAGTCTGACTTACATGTGTATCTTCGTCTAGCAGTGACAGAAGTGTCATCATGAAGAGACCATTGGACAGCAGGAGCTGT
CGACATTGAAGCTTGTGTGCTTTCGACTCCATCAATCGGCTCAACAACATGAATATCCAGTAGATAGCAACCGAGTTCTTGCTCACCAGAACCTTAGATA
TCGTGCCAATGTACTCTTCCCCACGCTAAAGCAAGGCAAGCACGAACCCAAAATTAACCAATCTTAACCCCAGTGAAACATGATAAAGCAGTGTAGTGTA
CCTCTGTCAGAATTTTCATGAATTCGTTGATAGCAGGGGGCGCCAACGTCAAGCGATAGAGTGACTGAAGATACGTACTCACAAAATCGTGAGTCGCACC
ATGACGACCCACAATGTCGTGCAGCTCACGTGCCAGGACGTAGAGCACCTTATCGAAAGGCTTGTTTGGCTGTGCAATCACACCGGGAGTAGGCGTATTG
ACGTTCAGCTCTAGCGATAAAGAGTGCATCTCTTCATCAAGGCCACGAGGAAGTTGCCGTTGCGTGCGTGCGGTCTTGCGATAGCCATGTACTGCAAGCA
GTTGTAAGACATTTGCTTGAGCGACACGGAGCTCACGGTCCATCACGTTCACGTTCGGCACCGTGTTTGCAATCTTGTTGCCTTCTTGCAAAATGATCTT
GCGTGGTATCATACGAACCGCGTCCGCAACTTCACTCATCTCCACTCCGACCTGATAGTTTCCCAGTGCGTGGCACGATGCCAGTAATTCACACACGATC
TTCTCGCGCTGCGCAGAATAGTACTTGCGCTTGACGCCGTCCGCGTAAACGACTTCAAATGCCTGCAGTGTATCTTGATACATGATCAAAGTGTAGATTC
TCGACAATGGGCGACTGGAAATCACCGTCTTGGCGTCTGCATACTCGGTAATATACTTTTCCGATACAGAAAGTGTGCGTGGAACAGCACTGGACTCGTT
TGACTGCGAAACCTTCAACACTTGATATTCAAACGACACACTGGTGCCCAAGGACGCTTTCCCATCGTCTTTCAACGCCGCCTCCATGGTTTTCTTGCGG
TACTCATTGATCTGCATGCCGTATGCTTTCATAACTCTGCTAATAGCTTGTGCCAGCTCTGTGCGTCTTGGCACAATGAACAAACTGGAATTGTCCGAGT
GATTCAACGCAATAGCTTCATGGTCGTCACAGATGACGTCGATGGAGACCAAACTCGTGTACGGGATATGACTCATGAGATCTCCTTCATTGTCTCTCTG
ATAAATGCCGTCAGGACGGATCTCCACGACGCAAGCGGACTGCACGCCGCTCTTGTGGTACTTGAGACTCTGAAACGTGTGCGTTTGCAGCTCGGCGGGC
GGGGGTTGCGGCGCATCGGGCATCTTGGCGTAGTGTTGACTACGTAGACGCATAAGACAGACTAGCACCTCCATACGGAAGTGGCAGCGGTACACAGTCT
TCTTGATGCGGTGACGTGGCGTGTGAATGACGAAATCCGTCTCGCCTTCTAGCACGTTGGCGCCATCCACGTCCTCATATGGCCACGTGTTGGTGACCTG
TTGGTTCTCTCGGTCCAATGTCGAAAACGAGTATTCTCCGAAGCAAAGCACTCGCTCCTTAACCACGAAGCTGCCCACCTTGTGCACCATGAAGCGCGCC
ACCACGCGCTTCATCTCCATGGTGGGGCAGGCGCTTGGTCTTCTTGGTCGCTTCTTCCTCTCTGTTCGTTCTCTCCTGTGTCTTGAAGCCTTGAGGTCTT
ACTGGATTCTCTTCTTCCACTTCAAGTGAATCACTACGCAGCAAGCCTTGAGCGATCTTCTATTGCCGGCCTTATTCGCGAGTGGCAGAGAGCGTGAAAG
GTCGTAAGGTACAGCGAGAGATCGACTAGGTGCGAGACATTCACTCCTGAGTCAACTTCAACTGCCGACAATCGTAAATGGATCGGCAATCCAGCTCATT
GCTGTGCGATGGTAGCAACGACGGCTCTCCGTTTCATGGGTGTGGGCTGGCCGATAACTGATCCGACTCAAGTACTGCTGGGCGGTTGTTGCTTCATCTT
TGTCAGAATTTGTATGTGTAAGCTAGCTACTGTGGATGTAGTATTAATACTGTACATCTACGTGAAACTAGCAATGAAATGAAATGGCTTCATCTCTCCG
ATTTGTCCATCATGGACCCCATCCGAACTGTCTGCCATCATTGGGAGCAAACTGTTTCGATGGATGAAATCCTGTCTGATGAATAGCGTCTTCCAAATGG
CATCCTAATGTATAGCGGGGCTCAAAAAGCTTCCTGTCGATGAAAACACAGTAAGTTCTGACCCTGAATGCAGTATTCTGCAAATAACACATATTGTCGT
GGTCGAGCAAGAGAACAACAGAGAGAACGAGAACTGACATCGGCAATTACAGTGTTAGTAAAAAGCTGGGTTAGTGTTAAATCAGTACTCTTTATCCTTT
TCCACCAATCACATGTATCCCCATCGTGTGAGGCCCACACGCGCCGCCTCACCACCAGAAGCACAAAAACGCACCTGCACCCCCAGCACTCCATTGTCCC
TCTAGATCCCAGCCGAAATGCTCGCGTCGTCGTCCTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGTGTGGC
TCTGAGTGAGGAGTTCCCCTCGGTCCCCAAGACGCAGCCGCAGGCCGCCGCCGCCGCCAAGCTCACCACGTCTACGGCCTCGTCGGGCCTGAAGCTGGGC
TCGGACGACCGCGCCGCCACTGTGGCCACCATTGGCGTGCAGCTCGATGCCGGCGTGCGCGACGAGACGGAGGAGACTGCGGGTATCTCGCAGCTGTTCG
CCAAGATGGCGTTCCACGCCACGGCGAACCGCTCGGACCTGCGTCTGTACCGCGACATCGAGGCCATTGGCGGCGTGGTGAACGCCCAGGCCGGACGCGA
CTTCGTGCGCTACAGCGTCAGCGTGCTGCCCGACCAGCTGGACGCGGCTGCTGAGATCCTCGCGGAAACCACGCTGGCCCCTAAGTTCGCCCTCTACGAC
GTGGACGAGCAGAAGAAGATTGTGCAGGCCGAGCTTGAGAAGATCACCGGAGACGCATCCGCTTCGTTGATTGAGAGCGTGCACTCTGCCGCCTTTTACG
ACGACTCGACCCTTGGCCGTTCGCTTGCCGCCGCTGAGAACCTCAAGTCGCTCAGCCCCGAGGCTCTGTGGGCCTACTACGACAAGTACGTCAACACGTC
CAACGCCGCTCTGGTCGGCGCCGGTGTGGCTCACAACACGCTGACGGACCTGGCTAACGAGTACTTCGGATCCTTCGCTAAGGGCGTCAAGGCTTCCAGC
ACCGCGGCCAAGTACGTCGGCGGTGAGACCCGTGTCAAGAAGGCGGGCAAGTTCACGCACGTCGCTGTGGCTCTGCCTACGGTGGGACGTGAGTCTGCTG
ACTTCGGTGCTTCTCAGGTGCTGCGCGCTCTGCTGAGCCTGCGTCTCAACAACAAGAAGGCGTCGGCTTTCCTGTCGAGCTACAGCGACGTTGGTCTTTT
CGGTCTGTCGGGCTACGCTGCGTCTTCGGAGGCTGGACTTCTGGTAGACTCGTTCGCTGCTGAGCTGAAGAAGGCTGCCTCGGCCCCTGCTTCCAAGGAG
GAGCTGGCTGCCGCCAAGAACACGGCTGCTTTCGAGGCTCTCGAGCAGTACAGCACCCAGGCGGGTGCTCTGGGCCGTCTGGGTCTCATTGCCACCACGG
GTGTCGTGTCCAAGTCGCCGTCGGAGCTTGTTGAGGGTGTGACCGCCGCCAAGCTGCAGGAGCTGGCTCAGAAGGCACTGAAGGCTACCCCTTCGGTGGC
TGCCATTGGCAAGCTGTCGACCGTTCCCCACGTGGACGTCGTTGCCAGCAAGCTGCAGTAAACGACCAAGGCGACCGATCAAGAGTGAGGTACATACATT
AGCAACCCGAGCTTTTGGTGAGGCATGTTGAAGTGACTTTGGAAGTGCGTGCGGATGAACAGGAGAGCGTCGAGTGTGGATGTAGCGCTGTGACGTAGGG
ACGGAATGACCTCGCTAGTGAGGTGAAGAGATGACTGCAGACACACCCGCAGCTTGCCTAGCGCCAAGGTCACGAGGCGTGCGACGAGCGCATTAAATAC
AAGAAAAAAGACCCAACTTTTTAACGACAATGCTCGGCGATAGGAAGCCGCTGTTTTGTCTCGCATTCTGGTAATTCAATCCGCTAAGGAGCTCACAAAT
GGCTGCTGCAAGAACAGGTTGTGTCGACTGGCTTGTGCCTTGAAGGTACTGCCTTAATTCAATGAATTTCTGAGACACCGCCCAACAGCATCATGACCCA
ACTTGACAATGCGCCCGTCAAGGTGCCCAAGCTCATTAGAATCCCTTACTATGTGTACAGCGAAATGCATCATAAAACACTGTTGCGTTCGTGGTTGTGA
GCAATGTTATCTCCAACGTCAACCAGGACAATGTTAACTCCAAGGGTAGTGCTAGCATGCCTAAAATCAGACAACTACATGTACATGTATTTAATAAAGC
TAAGCTTATCACCGCTTCTTCCTCCAAGTATCTTCAACGGCCAATATCAGCTGCTGACTTACTTTCCTTCTCGCGCCGGGCGCGAAGAGCTTCGCGGACT
CCAGGAAGCGCTAAAAATTCTTGCATAGATATGGGCTTCATAGTCTTACAGCCACGAACAGGTTCCGGGGGCAGTAGGTTGTTCTTCGGCTTTTTGACGA
GATTTTCGTTAGCGGTTCGCCCTTTACAGTCCGGTGTCTCGTTTTCGGCCGCCGCGTAAATCTCCATATTCGACCTCTTTTCTCCGCGACGCGTCCCAGG
TTCCTGTGCCACCGAGTTGCCTTCGTCGTCGCTGCTAAAAGTAAGGTCGATGAACTCTTCGTCGTTGTAGTTGGGCTGCTGCTCTGCAGCTGGTGGATCT
TCTGCAGCGGGCGCTTTGTCGGCGACTGCCGCCACCTCTGCATCGAACAGCTCGTCGCTACTGCTGCTGCTCACGAGGTCTATAGCTTCCTCCTTGGTAG
CCATTCTGCAAATGACCGTATTTCCAAGAAAATGTTGCTGCAACATTTTTTTCGATCCTCGTGAGGATCTACACTGTACATGTTCAGCAGCGCCAGCGAA
TACTGTAGATGGTTGACCTCTTCGCGTTATATTTGCTTCTGGCAACCTGCATCTACTTGTCCTTCTGATAACTGGTCTCGTCAGCTGGCCACAACGCCCC
CCAATGTGCTTTACGCGAGGCACGATACACCTCACGAACCGTCTTACCCTTCGTGACACTGCGACGTTCCAGCTTTCCCTACAAATGGCCAAAACACCGA
GTCTGTCAGAAATTGCAACGGAGCACATTGCGACTCAACCGAACATCTTACCTCAGGAGTACACAGGTCAAGATGTACGTGACGTGTAGCAAGCAATGGA
GCTCTAAGCATGCGCGCAACTGGTTTCTTCGTCTTCGCAGCTGCATCTTCATCACTGTCCTTGCGAGTCTTCTGCATAACCATGTAAGAAAACTTGGATC
CCTTCTGCCCGTGCCAGCGCTTGGTGGTGGCTTCACGGGGGCGGTTTACAACGGGCGAGCGCTGTACAAAGTGGCACCAAGTGCTTCCAGCTGCAGGACA
CTGTTTAACATCGCAAAAACGCGTAAGTTAATTGAACACAACAGCCTTTCGTCAGAGCAACATACCTCAAAGTGATGCGGACACGGAGCCACAATACGGA
CACCTTCCTTGCCCTCCTCATCTTCCGCGACGGAATCCATCACAAATTGACGGGCCGACCGCACGTGGTGCGATCCCCACGGGCTTCCACGATCCACAAC
CACCAAACATCCGTTCTCGCTCAGTAGTTCCCACAGGGCCGAAGTCGTGGCCACCCGCTCGAAGTCATTGGTGATGTCCGAGAACACGTAGCTCACTACA
ATGAGGTCGTACTTGTTCCCAGCGTCAATGTCCCTAGACATGTCGGCGATGCTGCGACGCACACTGAGACCGGGGAAGTCCTCAAGCAGCACTTCAGCAG
CGTCCACCATGGATTGGCTAGGCTCCACAACGCGAAACTTGTCGATTGAATCACCGTAAAAGTCTTTGGCAACCCAAGACGCCGTACCAGGGCCAGCGCC
AAAGTCCAGCACGGACTTTGGCTTGAATTCTGGCAGCCGCTTCTGCAGTTCGGTGAACACGGCGTGCGTGCAGGCGTAGGTGGCCTCCATCTCGAAGGCT
AAGTAGGCCCATGTCTCGGCCGGTCCATAGGCGAAGGGTGGGATCTGCTGGCTGCGGTCCATAGTCCAGCCCAGCGGCGTCTTGCTCATGTCCAGAGGCA
GTTGGCGCGTATTCCGGCGGTCTCCCACGTGCTTCTGACGTAGCGTCGCGAACTGCGAGTGCGTGCGGCTGCGAATGACAGAGGTCAAACGCTTCAGCAT
CTCCGTCGGCATTTCCACGCGCTGCACCAGTCCATTGCGCGAGAGCTGGTCGATGTCCGCGAGGATGGACGGTGTGCGCGGGTCCGCTGTGTCAGCTGCC
TTAGCTTTGGCCCTGCGAAGACGTCGAGCGCGACGGTTGGCGGCAGGGGAAGAGAAGGAAGCGCACAGCACTGGAGCAGCCTTGGACGGCGCCAGGAGGC
CCGTACACGCACCGTTCACTGCGCGTAGCGTCCGCAGCATCATCAAGGACAACTTGCGGATTGGTGGTGACGGCTGACTATGACTGGACTAAAAGTTAAC
TCCAAAATGTGATTTGAGTCGGACTAAAAACTCATCTTGGTGGACAAAACCGATCATGCCCGGAGCATGTACTGAACCTGGCTGTACCCGCCTCGTGCGC
TCTCGAGGCCGATGCAAAGCTCACGGTGGAGGCCGTCGATGCTCCGTGGAAGGCTGCAACCGCGGCAGTCAGACCCAGGGGCTCTGTATCCGCCACGGTG
GAGGCCACCGTTGCACTAGCCCTGGATGCACGAAGGCGTCGCAGTCCAACGGCCTGTGTAAAGCACACGGCGGCGGTGCTCGCTGCCAATACCCGAACTG
CACGAAGAGCAGCCAGGGCGGCGGCTATTGTCGTGCTCATGGGGGCGGTCAACACTGTAAAGAGGAAGGATGCATCAAAGGAGCGCAGCGTGGGGGACTA
TGCACGAGACACGGCGGCACGAGGTTTTGCCAGCATCCAGGCTGCTCCAAGAACGACCGAGGCGGGGGCTTGTGCGCTAAGCATGGAGGCAAAGTTCGTT
GCACTAACGGAGGCTGCAAGAAACTGGCAAGGATGGCTGGTCAATGCTGGGAGCACTGGGCTGCGGCTAAGGGAGAACTACCGGACGAGGCATCGACTGG
TATGGATAGCTCGGACGAACTGCGAAATGCGCCGTCAGTGACTACAGAAGTTACGCAAGTTGGGGTCAAGAGCTGTGGATCAAAGGACGAAGATGACAAC
GCTGTTGCTGCTGTTGGCCCCGCTGCTCTTAACTTATCAAAGGAAAACGTATCTCGACAACGTGTAGGAGGAGAGAACTCGAATGAGGCGCAGACAGCTT
GTGCAAGGGCATCGACAATTGCTGCCTAGGGATGGCACCGTACGTTGGTTTAATACCATTTCTGGTTTTCAGTTTCTAACTGTTTTTTTCTTTGATGAAG
GATACATGTTTGAAACGAGAGGTCCTCAAATACCGAGTGCAGTCCGGTGCAAATGGCGAAGGAGGTTCCTACCGACGACCTCTTCTTCTGCACGCAAGTG
GCATTCGTTGTCAGAGTGGCTGTGGCTGATAACCCGAGTGAAATTACGCAGATCCGACAGATTGCGGATGCCGTTTGCGGGGTGGTGCCGAGCGACAACC
AGGTGCGTTGACTTCCAACTTTTAGTTGGTCTTGGAGTCTTAGTGATACTTGCTCGGTAGTGTCACTCGTTCGTGAAGCGCTTCGACGCTGTTGTTGATT
CTATCCGGAAAGGCGAAGAGCCGACGTCTATTTGCCGCAACCTGAAGAAGTACTCGGCGGACACCAACCCTGCAAAGCCGGAGCTTGCAGAACCCGATAT
GATCGCTTTTCATAGCAGAAACAAAGATGGCAGCTCGCCTGCCTACTGCAGTGGCATTGTCACTGTCCTCAAGCACGCGCTCGCTCAAAAACCGGAACGC
GTTAAGGAAATGCGTGAAGCTGCAGGCCTCGCGTGTGGGAAGCTTCCCGCTGACGATACGGTATGGAGAAGGGTGCTTTACTCTCTTCAGTGATGAACAA
CTGACGTGTACTTGCTGATGTAGTGCCGCAACGATCTCAAGTTGTTTGATGAAGCAGTGACCAACCTTCAAGCTGGAAAAGATCCTCAGGACATTTGTCA
AGCGCTGAAAGTCTGTACAACATCGAAAACTCCGTAGATAGTTTGAACGGTGGGTCATCATGACGAACAACCCTTATAACGACGGCACTTGTGAACTTGA
TTTTACAACTTCAGCACCGTAAAGTGGACCAGGAGTTTAACAAGGGCTGAAGGCGGCAGCATCTCGATGACCTCGATGGTAACTGATGACAGCAGCAATG
ACGCCTCAACGAGTTTTCTTCAAAAGCGACCACGCGGAAAACCTTGGTCGGAACTGCACCGTGATTCTCCTGCCTGGGTGCCATGACCAGCAAAGCTTGT
ACTTGAACTTGAACGCCTCAGTTCAAATATATCGAGCGTCGACCTTGCGACGCACGGCACGAAGTTGCTCACGCCAGGATAGCAGGAAGTGCTTTGATCC
TCCATCCTCTACTTTAGAACTTCTCGCATGAGAAGCTCTTGGTTCGTATTCCTTGGTTGTTTGTGGTAGTGCCGAGGCCAATTCCAACAGTCTCGATGTC
TACAGCTCTGTTGTCCTGGCTAACGCTGCAGAAGCGAGATCTTCGGGTCAATAGCTTTAACTTGCTCACGCTGGTCTTAGCTGCTGTTGCTTAGGCCAAG
CGCCTCCATACTGTCGCACCAGCACGGTGAGTACTAAAATGAAGTCATGCGCCCCCTCACGCCTGTAGCGCGCATAAGGCGGGCCTGGGGCTCTTCTTCG
AGTTCTCATGTGCGCGACCATCCAAATGACCTTCCGGCAGAAAAGGGCAAAGTGTTCTAGCGCCAAACACTCGCCCACACGGGCGAGGCCAGCGTGGCGG
GCGAGCCTGCGGTGAGCTCCAGAACAAGAGCGCGGCCACGGAGATGGAGGGGTGGCGTAGTTGATTGAGTGGCACCGCGTGAACGAAGGCGGCGCGGACC
TCAAGCAAGGAGCTCCGGCAGCCGAGATGCTGGCATCGACACGCGTGCACAAAGCGGACGCTGCCGCTACAGTACGGTACGGCTCGGTCCGCCCCGCCGG
CGCTTTCTGCACGCCAAAGCCCTTCTCTTGCATTGCGGAGCTCGTCACCAAGATCGCGGGGCGATAACGGAAGACCGCCAACCAGCAAAAGTCACTTGGC
CGGCATGACACCGGCAATTGCCGCCGCCACGACCGTTGCAGTTACGGTATACTCCTTGTAATTCCCTATAATATCTTCATGCATTTAGGTCGGTGTCGGC
ATGTACGGACTAGCGGATCCCGAGCTCGAATCCTACGAGCTGGCGCCGTCGCCGCCGCGCTCCACCCACCTCAGCGTCGTCGACGACGTTCGGGGCTGAC
GAAATCGAACGTGCTTTGCAATCGTCCCTGGAAACCAGTTGCCTTGGGGAGCGCCAGGCGCTCTGCGATACGCGAAGAGCCGGGCCTCGCCAGTCACCTC
ATCTCGCCTAGATCAAGTGAAGGAGCTGCTGTTTGCCACGTGCAGTTGTTGCCGTCGTTACTTCAAAGCGCCGGGCCCCACCAAGCGTTGATGACCCAGA
TGAGCTGCAGCGCAATGTCCGCAGGTCGAGCGAAGCTCACGGCCACCAGGCGGCGCTGGCACCAACGCTTTCCAGCTGCAGCCAAAATGCTCGCCACTTC
GAACTAATGAAATGTAGCCACGTCCGTGCACAGTGTTAATCTCGGCGCCGCGGTTTCGTAGCGCCATCGGCGACGACCGCCGTGGCTCTTCTCGCTATGT
CGGGCGCGCCCTTGCAATTCTGAAGTGTAAGGCAAGGCCTCCGCCACGCGCGACCGGTTTTGAGGGCCAGTGAAATGCGCGCCAAAGCGGCCATGCCGCT
GGACGAAAGGAGAGACCGGCCACTGCCGGCATTGTCGAATTGGGTCTCTGCGGCGAAAAGGGCCACGCAGTCACTAAGATCCGTAGAGGTCCTGTTGCGT
TGCCTTTCACAGCAAAGCAAGCGCGTTGAGAAGCTCTGCAGAAGACCAGCATTTGGAGTGCAACCACAGCAAGTTGCTGCTGCCGAACTTCGGCCCGAAG
GCGGTTGAAAGAGGGCAAGGCACATCGTGCAGGAGCTCGCTGCTGTTCTCGCGGAGCCGTGGCTTTCACATCGCCGGTGATGAAATCTTGGCCATACAGT
TTGACTTGCATTTTGGCGACCAGGACGCGCATGCCTATGACACGCCGTTAAATCGTTTGATCCACGTTTGAATTCCGCCAATCACAGTGCCGTTTGCTCC
GTTTAAATCGCGCGCGAATCGCGGCGATTGGTTCATCTTGCGCTCAGTGCCTGCTCTCTTGTCACGCATCACGCGTCAGAAAACGTCCGGGAGGATGGGC
TGGGACACGCGAAGGGATCTGGACCGGCTTTGAGCGAAAGGGGTTGTACCTTTGCGACCGCGTCGTTAGCCGTGATTAGATGGTCACACTGGCGCTTTGG
TTTCTTGCTGGACGACAAGCAAGTTTAGCCAAGCTATCTCTGTCGCTGCTGCGTCGAGCTATTTTGCTGCTTTGATCTGCAACCGGAGCCAAAGGTGCTA
AACCGCCGAATCAGTTTGACACACGTGTCTCAAGAGAACAGCCACAACGCTGCGATTCATTTATTTGAATCGCAGCTGCTCCCCTAGCCTCCGCGGCTGC
CCTTTTTTTCCCGTCTGTGCATAGCCAGATCTCGAGGGGGGTGGCGCGGCGCCTGCTTCCGAGCTCCAAGTGAGTGGTCGTCCTGCGCTTACCATTGTGT
TTCCTACCAGGCCGTTGGTACTCGCTTCGTCTTCGCTCTCGCGGTGCCCGTCTCCGAGGCCGCAAGTATTTTTTCTGCCGGAGCAGGGGCAGCTAGTTTT
ATGGCCTCCACGTCCGCGTCCTCGGCGTCCCAGTCCACATCCACCAGCGGCGCCATGCAGCCACAAGATCCCAGCGCGCTCGACGCCTCCGCCTCGCAGG
CCTTTAACTACGACGCCGCGTCCTACCAGCAGTACGCGCAGGAGCGGGCGCTGCACGACCAGGCCGTGCACAACTCGATGGCGGCCGTCAGCGGCCCGGC
CAGCGCGTCCACCAAGCCCGTGACCAATTCTGCTCCCTCGCAGACCAAGGAGTCCGCTCCGTCGCGCCCGAAGGTGGAGGTTCCGTCCGCTAGAACGTCC
CCCACCAGCATCACCAAGGTCGAGCCCGTCCCCGCTTCCACGGCGGCTAAGACTGCAGCCGCGTCCACGCCGGTTCGCAACGAATCGCTCAAGTCCAACC
GTCTCTGTACTATGCCCGGCTGCACCAAGCGCGTACGCTCTAAGGGCCTGTGCAAGGCTCACGGCGGCGGCCGTCGCTGCATGGTCGACGGCTGCGAGCG
CAGCAGTCAGGGCCAGGGCTTGTGCATCCGTCACGGCGGAGGCAAGCGCTGCACGCAGCCAGGCTGCACCAAGGCGTCCCAGTCCAACGGTCTTTGCAAG
GCTCACGGTGGCGGCCTTCGTTGCCAAAGTCCTGGCTGCACCAAGAGTAGCCAAGGTGGCGGTTTCTGCCGTGCCCATGGTGGCGGCCAGCGTTGCGAGA
AGGAAGGATGCAACAAGGGAGCTCAACGCGGCGGCTTCTGTGCCGGCCACGGTGGCAGCCGGTTCTGTCAGCACCCGGACTGTACTAAGAACGACCGCGG
CGGCGGTTTCTGTGCCGAGCACGGCGGCGGCAAGCGCTGTGACCACCCTGGATGCAACAAGCCCGCGCGCAAGAAAGGCAAGTGCTCCTACCACGCCAAC
GCCGCCAAGGGCAAGCTCCCCAAGGACCAGCTTGCTACGGCCGGAGTGGCGGCCTCTTTGCCGCAGCACATGATGGATATGCGACAGATTACCACGCCGA
CGTTTGCGATGGGTGTGAAGGATTTGCGTGACCCGCACCTTGCTGGCCAGGTTGACGCGCAGCGTGCTGCTTACGTGCAGCAGCGTGTGGAGATGGACAT
GCGTTACAAGGCCTACGAAGCTCCTGGCAACGCCGGACAGTACCTACAGATCCACGCGGACCAGCGATCGTATGAGCCTATTAGTCTGCAGGCCGGTGCT
GCTGCTCGCTACCACATGCCTGACGGAAGCGCGCTTCCTCCTGTGTCTGGAAGCATGTACAAGCCTCCCGCTTCCATGGATCGTCAGGCGTATGCCGCGC
GTGCCGCGTCGGAGCAAATGAAGAACCCGTACACGCAGCATTGGGCTGCGAAGCCGGAGATGCCGCAGCACCACCCGGACGGAAGGGTTGACTATTTCGA
GGTGAACAAGGAGCAGCAACAGCAGCAGCAGCAGCCTGGACACCACCTGCCGTACCCCACTCAGTCGTCCCAGTACCACCACCACCTCAGTGCAGCAGAT
TCGGCTGCCGCTGCTGCAGCTTACGGCCAGCAGCAGGCTCCACGTGGATACTACAGCCAGCAGCCCCCGCAAGCCCCCGCATCTGGTGATCAGTCGGCCC
CCCAGCAGCAGCAACAACAGCAGCAACAGCCGAACATGATGTATTACTCGAGTAACGGGTACCCTCAGCACCAGATGCACAACTTGCAGCAACAGCAGCA
GCAGATGCAAATGTTATAAGCCAGCAATACCAAGTGCAGTCGCCGAACAAGTCTGCTTCCTTGCACGTCGTGCTATTTGAGACGATGACGAACCGAGTGC
AAGCGCGAGGGACGAAGTGAACCGACAGCACTGCTGTAATAGAGATAGAAACAACCCCCCGCAATGGATTGGAGCTCCTCGAGCGCGAGGAAGCGGCAGA
CAAGTGTTTTTTATGCCGTCGGCTTGGGAACGTAACCTTCCTCCCAGCCAGTTTTGATCGAGCTAAAAGGAAGGATTGAGCAAAAGCATTATCCCCATGA
CCATCTTTTGTGTTGAGCCTTGCTTTCTACACCCTGTGGTCCATGTACAGCGGCACCACCAAACATCTTGGTGTCTTGCACGCGCAGAAGTCTGCAACCA
GCATCACCTCCCCCTTCTCTTGCTTGTACAAGCCCAGTCGCTTTCGGTGTGGGGGCCAAGTGCCTCGACGGGGCAATGCAGCGTCAAAGGCCGCAGCCAC
CTGGTTCAAAGGCTCAACATGTTACAGTTCATCAAGTCCACTACACTGCTCTAATAACGGTTAGATCCTACGAGCTGCTCCGACTGAACTCTGTCGGCGT
GGACGCTCGTCGAGCCAAAGCGGCTTCGTCCTCGTCTTCATAGCTGCTCAAGGCGCCAGCTTCATGCTGTAGTCTGGCTGTGAAACTGGTGGCTCGTCGA
CGAGGTGCAACGGCCGCGGGGCGTCTTCTACTGGGACTGTCAGCGGCCGTAGGGCCGCGCACATCTTCAAGCTTCGCGTTGCGGGCCGCGCCGGCCCGTT
TCGACTGCAGCTTGGCCTGCAGATAGGTGCCAATAGCCGACGTGGGTATATGCAGCGGCCCGGGGGATGACACGCGCGGCGATCCGGCCTCCTGGTTGTC
GTCCAGGGCCACGCGGAAGCTGCCTTTGCCTGCGTAGTATTGGCGATAGCACTCGACCAGTTCGTGCTCCAAGCCCGCGTACGTCTCCAACAGCTGCGCG
GCTGAGGCCTCATTTCCGGGCTCGTAGACATGCAGCAGACGCTCCAGTTCCGCTCGGTAGTCGTCGGTATCTCGCTGGTTGTCGCTTGCGCTGGGGCTGC
CTTGGCTCGGACGCATTTGGGCGGAGTTTGGTATCTCGAAGAAGTGGAAATGGACTCTGTAGCTCCTCGCTGCACAATTCTATATTATATTTTTTTGAAA
CGGCTTTTTTCCATTCTTTGGCTTCAACTAGACCATGAATGAGCTCAAAAAGTCTCAGGCTGAAGCAGTTTTCGCTTTGGAACAGACGGAGTTTTCGGTG
GTGCTGCTGGTAAAACTGCCGGAAGACATGGAAGATCCGAGCAGCCTGTTTCTAGGACTCCCAAACTGCTGGTTGTTGCCTTGAACAACGATCTTTACTC
GGCCTGAACTTCCTTTAGGAGGGTCTGGAAGCATTGGATCAGAGTGGCAATGCCAGTCCGTAGCCCTTCGTCGCGCTTTGGGGAAGTAAACTGCGTCGCG
TGGGCGAAGTCGATGAGGCGGATGTCGGCTGCATAGGCCTCTGCCACGCCCTTGTCGTCCTTGGCCGACTCCTCGCCGTCATATAGAAACAGGAACGAGC
TGGCGATAAACTCCGTCCGTTGTTGATCGTCGAACCACGCCTTCAACTGATCCAGACGCTGCAAAAACTGGATACAAAAAACAAGAGCGTCAGGTTCGGT
TAGCTTACCGAGCAAACACTTGAAACAAACCCAACCGCTTCCAACAACTTGATGGTCTTGGTCGTGTCTTCCGGTGGGAAATACTTGCGGAAGGCGGGGA
CGAGCTCATTTGCAGATGTGATACCACGCCCAAAGTGCTTGTCGAACTCGACGTATTCCTTCTTCTTCGGGTCGAACACCTTAATTCCTTGAATACGGAA
CCCCACCGTCTCCTGTAAGGGAAACTTGGACTTTTCGTACGCGATCTTCTCTGGTGTCGCGTCTTCCTCATAGGACTTGGTGCCCATCTTCACGTCCATA
ATGCAGGGCCATTGTCTCCCCCACGTCAAGTCCTCCAGCATTAAATACTCTGCACTCAGTAACAGATACGTGAGTTTTTAAACTCCGAAGCTCCAAAAAT
CTCAATCATACTTCCAGAATGCAGTCCTTGGGTCTCTTTGCCTTCTTCTACCTCCATTGTCCCATAATAACCCGGCAGAAACTTCCTCAGCTCTACAAAC
TCGGGCGAATCCTTCTCCGATACAAAAACGCGATTGTATAAATCTGCTTCTCGCTGGCCACGCTGTTTGCTCTGGAAAGGTTTCAGGATACGCCCATTGT
GAGACTTTAGACCTGTCCAACGCAGTGAAAGAGGTATATATTAGATGAGAACAAGGAGGCAATGCAGACTATCTATTGCACTCGTCAGTACTCGTGGCGT
GGCCGCCCACTTGGTGTGCCATCTCCGTGAAGCCCTCCATCTTTTTTCTCTCTTCAGTTCCGATACAATTGTGATTATAGTCCATTTTGGATCTTGCGTT
TTGTGACGACTCAGATTTGCAACTGAATAGCATGCGTGTGTTGGTGCTTGGAGGCACGAGCTACGTGGCGCAGTTCGTGCTGCAGCGTCTGCAGCAGGAC
GAGACGTTTCGAGTAGCGAATGGAGATGCATCGGAAGAAATTGAATCTGTGGCGTGCACGATGCGCAGCGAATCATTTGTTCTCCCTGAGGGTTTTTCTT
CGCAGACCTCAGTACAGTCGAAACGAGGTGTGTGCGTGTACTGGGGAGTGGATGTGTTGGCTCCAGAAGCTCTAGAGGAGTGTATTAAGGACTTCCATCC
AACGGTGATCATCAATTGCACGGGTACGTTACGGTGGGGCATTTACGACACGAACCAGACACTCAAATTGAAATTTGTGATACGTGCAGCGATCTCTTCA
CCTGCAATTTGTCAGAAGGACCCGGAGAACGCACGAGCCATCAATGAGGTAACGAAGAGAGAAGGAGTTAAAATAATGCTTGGTACTCATGTAGAACATG
TTTTTGATCGGTAGCCAGAAGGTTTGGTGAGATTTTTGGAGAAGCTGCCGTGGCGAATCCGTTTCGTGCACTTGTCGACGGACTTTGTATACGAAGGAAC
GCAGTCTTGTGGTGGAAGTTATGCCGAAGATGAAGCTGTCTTGTCTCCAGACTTGTCGGTGTATGGGGCCGGCAAGTTGCGCTTCGACCAATTCCTGCAA
AACCGCGACGGCCTGACATCCTCGCTGCAAGTGTTGATCCTCCGAATTGCCAACGTCATTGGACCTACAGCCCCAATATTTCCAGACGAGAGTGCCCCGA
AGTTTATGCAGTGGCTGCATCGTCAATTATTCCAGCCCGAAAATGCTGATGCACCTTTGAAGCTGTGGAACGACGAGTTCCGCTCGTACCTGTACATCTC
CGACTTAATTGAGATCATGTTCCGGTTACTAGCTGCAAATGCCAAGGAACAAACCACTCTTGTCAACGTCGGTACGTCAGCAAAGCGTATGCAATACTTT
GTACGTGCTAACAATGTTTCGTGTAGGAGGGGCAGAGGCACTTTCGCGCGTTGGAATTGCAAACAAATATCTTGCTGCCAGTGCGAAGCACAGCCCGGAA
ACTGTTGCTGGAGTAACGAGGGAGATTGTGCCCACGTCGCGAGCTCAAATCGATTTGGGGTACCCTTCACCACTCAACACGAAGCTGAACACTGCACGCC
TCACTAATCTCCTGCCTAGCTTCGCGTGGACTCCAACAGATAGGGTTTTGGACGAGATCAGTCGAAGTCTTATGGCTTGAAAATGCTATTTCATTCAGGG
CATTATTCCTTTGCATTCATTAGTGGGGGATATGCAGAACGCAGTCACCAAGTAGTCAAACCTACACAAGAGAACGCGCCCCACTCGCGGTGATAAACAA
GAGCTCTCCAGTTACAGTTACTGGATCTCCATCAAGTTGCCCATGCTCTGCCGCCCGTTCTCGAAAGCTTGCACGATAGGGTCATCCGCTCGGCTCCCAG
AGAAGACAAAGTCCGCGTCGCACAGAGCGATGGAGTGACAGGCTTCGCTGGGACTCTTCCCCTCGCGCATGAGCGCCACCAGCTCATCAAACTTGGAGGA
AAGCACATCACAACGCGCACGCGGAGGCAACACCGTGCACATTGTCTCCAGAGTCATCTTGGCCTCGCGTAAGACCTTCTCATTGTCCTTGGCGTGCTCC
AAGAGATCGGCCGTGTACTCGCAGAATAAGCAGCCCACAGACATCGATTTTTCCTCCACCTTCTCCTTCACGGCCGCAGGCTCGCACTCCGCAATACGAT
TACAGATAGTATCCACGTCTTCGTTCTTCTTCAGTGAGTCAATGATTGCGTCTTGATGCTTCATGAGTAGCTCGCACTATTTCATACAAAAATGTATCGA
GTTAGACACGTGCTCAATTCAAAAGCCGAATGTACACAGCACACTTACCTCACTGGACTCCGGGATCAATCGGCAGATCGAGTTGATCTCGCGCTCGAAC
GTGACTAAGCTGTCCGGACGCGTGATCAACGAAGCCAGCAGCAGAGTGTTCTGCTGGCAAGTAGCGCACCTTGAAGGCAGGAAGTCCTTGCCCGTAAAGT
CAAGCAGACCGGACACCAGCCCGATGGGATTTTCCATGGCAGTGCAGAATTTCAGCGTCTGGCAAATTTCTTGGGGCTCCTTTCCAGCTTGTAGGTCGGT
CACTGCTTCGTCGAACATCTTCAGGTCGTCGTGACACTGCTCAAAACGCATAAACGGAATGCACATCAGTTCCATCGGAGAGCATACAACTCACAAGGCC
ACGTACCGTATCGTCAGCAGGAAGCAATTGGCACACGATGCCTGCAGCTTCACGCATCTCCTTCACTTGTTCCGGCTTTTGGGCAAGTGCATACTTGAGA
ACGGTGACAACACCACTGCAGTAGGCGCACGAGTTGCTTCCCGTTTCGCTGTTCTGAACAGCGATGATATCAGGCACCGCAAGCTTCGCCATGGCCGGGT
TGGTGTCCACCGAGCAGTACTTCAGGTCATGGCAAATAGCCTTCGGTTGCTCGCCCTTCTGGAGAGAATCAAGAACAGCGTCGAACTGCTTCACGAACGA
GTGGCACTACAAAATCACACAAAGCTATTGTCAGCACGATTTCAAAAGCAATTGGGAGCTGTGAGTCAACGCACCTGGTTGTCGCTCGGCATCATTCCAC
AAACAACGTCTGCAATCTGTCGAATCTGCGCAATCTTACTCGGGTCTTCAGCCACAGCCACCTCGATGATGGATGCCACTTGAGTACAGAAGAAGCATCC
GTCCACAGACACTTCCATCGATTCTTTCACCATTTGCACCAAAATCGGGTCATAAGCGGACAAATCGCTGTCCGAGGACTGTGGTGCAAGCAACGTGTTG
CTGGCCGCGCAGTAGTTCAGCGATTGACAGATCGCGTGAGGGTGCGTTCCGTTCTTCACCGAGTCCAAGACAAAGTCTAACTTTACCACGTACTGGTGGC
ACCCAGACTGTTCACCCAGAAGCGCACAAACAGTATCCGCCAATTCCTTAATCTGAAGGACCTTCGTCGAGTCTTGCTCATAAGCGGCCTGCACAAGGGT
AGTGGCGTAGTCGCAGAAGAAGCAAGTTTTCGAATCAGGCCCGTTGGCACCAGGATAACTGTCGACGACCAAAGCCGACACAGCATCAGTGAAAGAGTAG
CCGTCTGTGATCGTATCCACTTTCTTCTTGCACAGCCCAATGCTTTGGCAGATTTCGTGCGGGCGTTTCCCCTCCTTCTCCAACTCCACGATCTTATCGA
AGTTCTTGTCCACATCGTCGCACTTGCAGTCAGGAGTTGCCAGCTTGCACACATTAGTCAGGATAGTCTTTACGATCGGGAGTTTCCCTGGCTCCGTCTT
ATTGACGTGGTGAATTGCAATACCAACGTGAATGCAGAAAGAGCAACTGTGATTGTGGTGGTGACGCTCTTCCGAGCTCAAGACCACAGCATTGTCTTCG
CTATCAGCAATAGCAAGGTGCTCTTCCGTCGCTGTACAGAACTGAAGTTCCGTGCAAATGGCCTTAGCACTCATGCCCTTGGTGATAGAATCAATCACGA
AGTCAAAATCCTTCACGTAAACGTGACACGGGTTGTCCGAGCCCAGCATATCACAAATCATGTCCGCGTACGCCCGAATTTGACGAATGTCGGTGCCATA
TTGCTGGAGCGCGATCTTGGCCACAGTGGTTGCAAACTGGCAATACGTGCACTGGGTCTCGTTTCCAGGAGGCCACTGAGAAGCCACAACCACGCCCTTC
ATTTCATCGGCAATGGAAGGCTTATCTTCCTCCCAGTCTCGCGTCTTGTTGCAAACTCCGAGAGACTTGCAGATTTCGTGAGGGTGCTTGCCTTCCTTCT
CCATTTCAACGATTTTGTCGAAGTTCTTGTCTACCACATCGCATTTGCACTTTGAAGGCACCAGTTGGCATACGTTTGTCAAAATGGTTTTCACAACTGG
CAGCTTTTCCGGCGACGTGTGGTTAACGTGGTGGATAACCATTGCAACACGCGAGCAGAAGAAGCAACTGCCATGGGGGTGCGGACGCGGGTGAGGAGGG
TGTGGTGGGTGTTCACCATCTTCCATGTTTCCACGCGGGCCATGATCGTGGCGTCCATGGCGGCCTCCGGGGCCCACCATACTCACGTGGTGGTGCATGC
CACGAGGGCCATTTCTCATCATACCGACACGAGGGTTCTCATCCAACTCAGGAAGACTGTCCATTCGTTCTGCTGAGCAGTACTTCAGGGTCTTGCAAAT
ATCACGAGGATGCACTCCCTTCTTCAAGGAGTCAACCACGATATCCAACTGGTTCACGTACTCGTGGCACGGGCTGTCATCCCCCAACATGCCGCAAATC
ATGTCAGCGTATTCACGAATTTGGTCAATCTGCTCGGGGGCTTCTTGTAGAATAACCTCCACAACAGTAGTGGCTGCGTCGCAGTACACACACGTCCTGT
CGTCGCCGCGCATTCGATCCGAGGGTACCATGTCACGTGCGGGTTTCGCGGGGCAAAAATCGGCGTTAGCACAAACCTCACGTGGGTGCTGTCCTTGCTG
CACCAGCTCCACAATGTGGTCAAAGTTGGCCTCCACTTCCTGGCACTTGGATTCCGGCGAAGCCATCTCGCACACCGTTCCCAAGACCGGGTTTAGCATT
GGAAGCTGTTCAGGGAACAGCTCGTTCACTTGGTAAATGACACCAGCCACATGACTGCAGAAGAAGCATGCCTGGTCGTTCTCAACAAAGTCAGCGGTAA
CCAGAGCCGTATCTTCGACCGTCTTGGGTGCTTCGGGGGTCCATGGCAGATCAGAGACTTGGCTACCACTGCCGCTGTCCGGAGAGCACATAGCGATCCG
GGAGCAGACCACCAACGGGTCAGTGCCGTGCTTGAGCCAGTCCACGATGGCATCGAAGTTCTTGAGGAACGTGTGGCACATCGAGTCGGCCGACATGGCG
TCACACAGGTCGCCGATGATCGCTCGGACCTGCTGCACTTCCTGCACTTGATCGGCCAGCGCTTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGC
AGGACAAATTGTCCGTCCCCTCCAGGTCCGTAACGGCGGACATGATGTCGCACACTTGGTCGTCCGTCTTGCCCTCCAGCAAGAACTTCCTCACGACCTC
CTCCGACTCCAACACGAGCTTGCACTGACATCGCGAAAACAATGGGTTAATACACCTTTTCCCTTACTTCAACAATAATTGGAATCTCCAATTCCTCACC
TGCTCGATCAGATCGGGCTGCTCGAGGTCCTCGCACGACGCCTCCCCCCAAACCTGCAGTGAGATCATGTCGAAGGCCGAGCGGAAGTACCGGATCAGCG
TCTCCGCCTCGGCCTGCAGCTCGTCCTGCTCGTGGATTCGCTCCACCGCCTTCAAGCACGCGCGCTTCCTTTCCTGCGCCGGATCTTCCTCCACCTCCAG
CACTACAATGCGCACGACATCGCTCTGGGGCTCTTCCAGACGGAAGAAGCTCTGCAGTAGCTCACTGGAGCGCTGGAACTGCTCGTTCAGCGCGGTCATG
AACCCCACAGTAAAGTCTTCATCCTCGCTCTTCTGTTCGTTGTGGCACGGCATCTCCACGTCTTCTGGCTGGTGACGCACGCCGTGCATGTGCTCGGCGC
TCGCGACGGCCGCCAGACTCAGCAGGAGCGCGTACAGAGGCCGCATCGTTCGATCCCTTCTCCTTCCTTCTTCAAGCTCGAATCCTGTTTGAAGGGACCG
GCGTTGGACTCCAGTGGCAGGATGGATGGCACGAAGAGAGATGGGATGCACGTCTCTATGTAAGGGGTTTCTTAGTAAAATCAAGTGTAAATGGGATTTC
GTTGGGGGCGGAAAAAAGCGTCTGAGTCAAGTGGAAATTTAAAAGGATCAGGTTGAAAGACAGGGTGTCAACTATATGATTTTCGTCGTGGAAGAATGAT
GGTTGAAGTGGCCTAGCCAATCAGATTGAACGTATGTGCTGATCATCAACGGATATGTATGATCAACGGATATGATCAACTAACGTTGAGCATCGCAGTG
AGCTGGAGATGGCCGCCCTGAGTCGCCCGAGGTACCCACAGCAGTAATGAGCCCCCGCCAGTACCAGGGAGTCCCAGGAATCCCGGGCGCCACCTGTCCA
GATACAGCGTTTTGCCTCCTAGAACCGTCACGTTTGAAGTCCACCTAATGGTCTTTCCGGCAGGAACTGTCACCTTACCGAACTTATAGCCGCCGGACTT
GATGTTGACCGTCACATCCTCCGTATCAACGCTCCGGAAGGTAATGGCGACGGAGCCATCGCCAGACTTTGTCCAGTTACCACTACTGCCATCGAAGGCG
TCGTCGACTGTCTTTAGACCTAGCGCGTCTTTTGCACTCCCGTCGTCAATTTCTCCCGTGAATTTCGTAGGACCACAAATTGTCTGGAAGTACTCGGAGA
CGACGCCAGCGATATTGGTCAGATCCCACACTGCGTAGAAAGTAAGCGCTTTGTCTGCGATCTTGTAGGCGTATTTTTCGGCCGTAAGGAGGGTTCCGTT
GTGGCTGGTACCGGAGTGAATCAGGTCGTCCATGATGCCGCCGAAGCTCTTGCGGAGAGTATCCCGCGTCATGTAAGCTGTCTTTTCGTCGGACTCGTCG
ATCAACTCCCCCATGCAGTTGTTAGTTACAGTGGGGATCTCGTTCAGGACAAGATTCGACTTGCTCATTTCCATGCGAATATCGGCCTCGGAGATGATGG
GGTTATCCTTTCGAAGGCTTGCTACGGTCATCCATGTACGGTCCAGAAGACGCTTCATGTTGGATCCGCAAGTGGAGTGTGACTTTAGAGCCGACTGCAG
TGAAGAAATGTCCGACTTTTCTAACCCCTCCATCGGTTCGTCGAGGGCGATTCGCTTCATGAACGCTAAGAATGCAGCCCAACTGGCGAGGATCGCGTCG
TTATTGATCACTACTTCCTTCAAGAAGAGCTCGACCGTGTTGGTTATCCTGTCGGTTGTCCTGATACTCTCCGATACGTGTATTCCCAGACACGTACAGA
TCGCGATAGGCAAGTCGAAGACGACGTTGTCGGTTTGATAGAGCACTGTCTCCAGATATTTTTCCGTGCTATGTGGGTGGAAAACTTTGACAGTGCGAAG
AAACCTGGTCAAGTGCTTCACCAGATTCATCGTCTCTTTGCCACATTTGTACGCAGTTTTCACGCCTTTCGCCATCAACTTGAACTCGCCATACAAGCCA
AACGTGGCAAGGGAAAACGCCGAGTGAGCGATGACGGAAACTTTGGAAACGACTTCGAGCCCGCAGTCGTCGTTCTGGCGGATGCACTCCATGCCGCATT
TCACGGGGTATGATAGAGGACATTCGGCCCAGCAAATGCCGTGGTAGTTGTCGAATTCAAGAGGGCACGACTTCGCGATGTGGGCTTCACGGTAACACGC
TGTATCGGGGGCACCGCCAAGCGAAGATCCCACCCAATTCGTATGTGTTGACTCAATCGTGGATATGACAGCTCCATCAGTTGATCCATTGGATGTGTTG
GCTCCATCGTCGCTGTCTAAATCTCCGTCGTCGTCATCACTATTGAAGATTTCGTCATGGCTATCATCACTTGAATCGTTGTCTCTTTCTGAAGAATTGA
CGTGGCTTGGTCGTTCCGAGATGACGGTCTCTGCGGTAGTCAATGAATTGGTTGGTGTGGCATCACGGAAGTTGTAAGCTTGGACAGCAGTTACATTGAG
CGCAATCCCTGCGTTCAACAGAGCGAAAATGTGAAGCAACTTGAGCATCTGGATCGTTGTCCGCAAATGGAAAAATGAACTCGATACCTGAATGGGAGCT
CTGGAGGAAATTTACTTGGTTACAAAAGTTTGCTGCAAGAACGTAGCTGTTCGTAAAACTTCCCTTCTCAGCTCGTCGTCGGCTAAACTCGTTGTGCAAA
ATCTGTATGTATACAAAGCGGTAGAGTTGTGCCTATGATCAACAGCCTGGAACGTGGACTCGCATTGGTGGTCTTTAGCAGCTTCAAACTTCGAGGTTGT
CGATTCCGGTGCAGAACCCAACCTGCAAGATTGTTCCCTTGGATCAGTGGGGTCAGGTGATCTTCGCTTGGTTGTACACGACAAACATACTGCAGCACGA
CAGGAACGATTGATGCACGTTCGTACAGGCTATAATATCTTCACGCCACAGCGAGTGAAGGCCATCCTGGCTGAATCGATTGTCCGAGATAGCGATTACT
CGTTGCCTGTAATGGGAGTCCGTCTCAAGGAGCAAAAAGACGCAAACTTCAGGATTGGGTTTTTAGATCTGCTAAACAACCGGTTGCTAGTCGCTCCATC
GCAGTACCCGTCTCATGCTGCGTACATGCACGTCTAGTCGATGCCAATGCTACAGCTGCAAGGTATGACTTCGTACTGAGCTCGTAGATCAATCCATACA
CTGCATTTTACTCCTTCATGCTGTGTGTTTTTCAATGTCTATGCCGTGCTTTCAAAATCCACATCGTTTTCTAATCGACAGGCAGCAACTTCGGGGGGTG
GGCAACTCGGCGGGAAGGTTAGTTTGATTACCCCATTTGCATTTTACCACAGCGTCGTCTGTGTTTCGGCACGAATTCAAATGAGACGTGCCCCCATGTT
CCCGTCTTGCTCGCAAAGCTCTTACGCGAGGTGAAAAAGACATTTGTTAGCGCTTCAGTGCCAACAATGTCCACGGATTAAGCACGGGGGGATGTGCAAG
CAAAATTAAACTCCGAACGATACCACGTTCATGCGTCGCAACAGAGCACAACAACACGCACATGATGCACCTCACTCGAGTAGACAAACCCTGTGAGAAA
GCTTAGTCCAGGTACATGCCACATCTACGGTTGTGAAGGAAATTATTTGATAACGAATTAGTGGACAACTCTTTGGACTA