Description :
From Genome Similarity Track
Location :
Scaffold_16:64444- 68468
Transcript NameFunction/comments
g18058.t1hypothetical protein
g18059.t1ETI45733.1 hypothetical protein F443_09781 [Phytophthora parasitica P1569
g18060.t1XP_009526607.1 hypothetical protein PHYSODRAFT_351217 [Phytophthora sojae

Sequence
4024 bases(100 bases per row)
CTCGGTGTGCTTGTCTTTGGTGACCAGCTCCATTTCTACCTGCTTGAACGCGGCCACGTAATTGTACTTCTCATAACCCAGCCTGCATGGTGAAAAATGT
GCGAGAGCAGTTAGTCGCTTGCTCAAGAGCAAAACAGCACGACATGCAAACTTACTTTTCGAAGAGCTGCAATGAAGCACCGTTCGTCTCGATGATCTTG
CAGACAAATCGGGTGACGTGGAGCTTCGACGTTGCTGTATACGGGGAAAAATGAAGAACACAAGAGCTCGTTGGTCTCATAACTCAGCCATCCACGACAC
TGCTTCATACCGTAAGCCATCATGAGCTTCACTGCCTCCTCCGCAAATCCCTTGCGGCGATACTTCTCCTCGGCGATCATGATCTCCATCTCACACGCTT
TGGGGTCGTCATAGTCGTTGAAGAACAAGTTCACGTCCCCCGCCATGCCTGCAACCACCCATTAGTCACATATCGCGTCTTCCACCATAAAATCTCCCAC
ACAGCAACCAACTCACGGTCAACGGCACTCTCGTCGACGTACGAGGCGCCTGGTTTGCCGTCACCCTCGGACTTTTCCAGTACAATGAAAGTGCACTCTG
CCAAAGGCATCAAAAGGGTAGAAACTGAGTCCACACAAAACTATCTTCGGCATTGACAGCTCGTACTCTCGGCATCTTCTCTCCACGACTTTTGCATCTC
CAACTCCTCTTCGATCGACAGTGGCTCCGACGCCGTCATCTCTGCAGCAAAACAAAATCCATGAGAGATCCACAGAAAATAGGTTCACACTACTGCAAAA
TGGTCGCAATTACCTTGCAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGCCACATGCTGCGTCTCGTACGGCACCAGCGTCACCTGCTGCCCAGTCT
GTAGACAATATAAACAACACCGAACAATACTCTTCATTAGCTTCCATTGCACAATAATATAGGTACTCGTCAATGCACTGGCCGTACAATCACAACACCC
GCGTTCGCCTTCATGTTGACAAGTCTCACACTGCGGCCAGGAGCTAACTTAATAATGGTCCAATCATATTGTTTTTTACCTTGTATTCTAGAATATAGAT
AATGATAGATTGTAGGATTAGCTAGAAGACGTGACAACCAGATCAGAATGAGTGGCCTCGCCGCGCTCGAGGTGCCGTTCACGGAGGTTCTGCTGATGTT
ACTACGCCACGAGTGGGTCGATGTAATGTGCCTCTCTCTCCACTTTCGACTGGTAGAATTTTCGCTGCGTACTGACGTCTATGGGCGCTGCAATCTGAGG
TGAACGATGTGGAGGCCGTTGCTGGAGTGAACAGGAGCTTGCGATCCGTCGTGGAGACTCGCAAGCTGCGACGTCTAGCGGTGCGTGCCAGCGGATTCCC
CAAAGCTTCAAGATTCAGGTACGAGGTCCTTATAAACGCAAGTGGGGGATGGTTGGTTCAAGCTCACAGGTGTCCATGACGTTGAAGCTACTGGCTGCGA
GCTGGGGACGTGTCAACGCTCATGAAGGAGATTCCAGAGGGGGCGAGCAGCCAGGATTTGTTCCTCAAGGTGAGGAGACTGTTGAGCTTTGTAGGAGGGC
GGGGGCTCATGACGTGCTGTGCTGTGCTGCAGCTGACGGGGATGGAGAGGTTGGAGGACGAGGCATCGCTTGAGAGCACAGGCGTAGAAGGTGGGGATTG
TGCTGGAGACAGGAGAGATAGAGGAGAGAGTAATGGGCGATTGGTGATTGCAGGAGAGATCGAGCGCGATGTAGAGCGAACTTTCCCAGCGAACCCCTTT
TTTTCGGACCAAGGTGAGAGCTGTGGTCGAGGCATCAAGCTTCTGCTGGCGTTCCTCTTGAATTGACAGTGCTGTTTCGTAGGCGACGGTAGACGGATGC
TTAGCAATGTGCTGAAGGCGGTCGCTCATCATGCAGACGACATTGGCTACTGCCAGGTGCGTAGCTGGACGGTGACTGCAAGTAGAGCCGACCAGCTAAC
GACAAAGATGGCGCTGCGTGCGTTGCTTATCAGGGGATGAACTACGTCGTCGCTGCACTGCTGCTTGTGATAAAAGATGCAAAAGATACTGCTGACGTGG
GAATCGATGGACTCTCCCTGCAAGAAGCGGTGTTTTGGCTAACGCTGTCTTTGATTCGGCGCAAGGGGATGGCAGATTTGTGGAAGCGCAAAATGCCAGG
GTGCGTTTTATCTGGTATTTGGAGCTGAGACTACGTGAGCTAATTGCTATTTTGTATGTGGTGATGGTGCAGACTTTCCCAATGTATTTACCTATTTCAG
CAGCTGCTTAAGCTTCACTTTTACGATCTATCAGCGCACCTCCGACAAATTGGGTTGCACTCTAATATCCTAGCCACGCAGGTAAGAACACTGGGAATGC
GGGTTTATTCGAATCTTTGACATTTCGATGTGCAGTGGTTTGTGACGCTATTTGCTCGAGTGCTTACACTTCCTACACTTGTTCGAGTGTGGGATCTCTT
CTTTATGGACGGGTGGAAAGCGGTATATCGAGTCGCGCTCGCCATTACAGCAGAATTGCGACCAAAGCTTCTCATGATGGTATGGTGACGCTGCAGCAAA
CAGTCACCTACGTTTTCTGATTGCGCTCTATCGTTTTGGTTTACCGCAAAACAGGATTTGGAGCAGTGCAGCGAGTTTTTCCGCAAGAACCCAAAGTTGG
GCTTGGAAGAGGTATTTGGTCCAGGAATACTGCTGGAGCGTGCACTGGAGTACAAAGTGACGCGCTCAAGCCTGCAGCAACTGGAGGAAGAGCGACATCT
CGAGGTAAGAAAGTCTTGGCCAGTCTTCTGTCAGGACAGATTGGTAAGCTGGTTGTGTATTTCACGCTTTGTTAGTACTTGCGTCTTCGACTACAGCAAA
CTCCACTATCCGAAGAGCATCGTATGCTGTTTCCTGCCCTCGAGCGTGAAGGCGATGCTGCTGCACAGCGAAAGGCTCTGGAGCTGATCCGTTCAAAGCT
GAAGCGTTTCGACTCGGACGTCGCGAGTGACACAATTATTCTTCAGCAGAAAATCGAGGCAGCTGAGCGCGCGCAGGCCCAGGCGATGTCAGTTCGCTAT
GCCATTGCGTACGAGCTGTCCGAGGCTGCGATTGAGCTGAATGAGCGTGTCGAGGTGAAAAACCGACTGCGCTCGAAGTTCCGCAAGCTCATGTCAGTCG
CGATTGCAGCAGCTTCTTCGTCGTCGTCTTCTTCAGCAAGGTCTTCTGCGTCAGTCCTTCCGAGCTGGGTCCATCCGTTCGACTTCATCAACGAGCGAAT
GGCCAGTTGCTTTGAGCGTCTGCCTCTGATTTCCAGCTTTACCGACAGCGGGTACATCGACACCGACGACGAAGAAGACGAAGAGGTACAACGGAACTTG
GTGCATCTCAATGCGCTGGTGCCTGAGATGGCGGCAGAATTGCGTCTCCTGCAGCGCTCGGTGGCCTACAACGAGCGCTTTCTGCGTCCACTGCTACAGC
GGACGAGTCGCCTTCAGCGTGACGCGCAGCTTGCTCGTGTTGAAGTGGAGGAGACACAGCAGTTCAAAGACCGATTGGCAGACCAATTGCTGCAGATTAT
GCTGGCCAGCGAGAAGCTCAAGAACGAGCGGATGCAGCAGCTCTTTGCTGAGGTCGATCGTAGCTGATAGCACGAAGGACGCTGCGTACGTGATAAACGT
TGGAAGTATCTACTGTATTACTACCGATGTGGAAGCAGACACGCACTAGAGTAAAAGGCGAAAGACCTCACAAGCTCTTCCTTGGTAGCAAGCGAGGGCT
TCTCCCCCTTTCAGCGTGCTTGGTTCCGTGCTGTTGTATGTCCAGAGGCGGTCACACATGAGCTAGACCCTCTTGGCTTACTCGTCCTCCGTCACGACGT
CAGCGTCCGCGAACTCGGCCGCCACGGCGGGCTCAGCGACAATGGGAGCCATGCCCGGGCCCCACGAAGGGAGATCGGCAGCAACGCCACCGAGCGACGG
GAAGGCGTCCTTGTCGCTGGCGTT