Description :
From Genome Similarity Track
Location :
scaffold_5:644358- 645651
Sequence
1293 bases(100 bases per row)
ACCTTACTTTGCCCGCTGTCGAAATCCAGATGAACTTTGGTAAGCTTGCTCCGTGCGCAGCATTGAAATCGGGCACTGCTAAACATTTTTGTTTTTGCTA
GGGTATCACTACTTGAAAAGGCATATGCGAAGTTGCATGGGAGCTATGAGTCACTCATAGGTGGATTCGTCGACTGTGCTTTGAACGACCTTACTGGAAT
GTGCTCTGAGCAAGTCATCTTGAAAGACGGGTTTCCTGGCTTCGGTGAAAATCCTTATACACCAGAAAAACCACAGCAGAAGAATGGAGACCCGTTTTGG
GAGAAAATCACTCGATACAAGCAGTCCGGAACGCTTATGGGGTGCTCAATCCAGCCACCCGTCACTTCGTCGAAGGATGTCGCAGTAGAATCGAGCGCGG
GGAATGGCTTGTATTTCAAGCATGCCTATGCTCTTGTTGACGCCGCTGAGATTAAAACGGGGAAGGGGGAGTATGTTCGGTTGGTGAAACTACGCAACCC
GTGGGGAATGGGGGAATGGGTACGAGACTCTGGCGTCTGGAATTGGCATTGAAGTTGATTTAACAAGACTCTTTTGATGTTTCTACATTAGACTGGGCCA
TGGTCAGATTCCAGCGACGAGCGTGCAGGAAACGAGGATGCCATCGAGAAGTTCTTTAAAATTTTGAAGCGCAAAGTTGGTGCAAACGCCGAAAAACGCG
TGTTCATGACGCTAAATGTCCAGGGCAAAGTTGGCGCGGATGAGATTTCTCAGGAAGAGGTTATTGAAATCAACGCCAACGACGGAACCTTTTTCATGTC
CTTCGACGCTTGGATGCAGTCTTTCACCCACTTTTTCGCTGGAATCGGTATGCTGGTTATTATTTCGCTTATTTTTGATACCTATCGTAGCACCCAACAG
TCTAACTTCCTGCCTGTTCAGATTTCCCTGATTCCTGGCACGGACGGCGGTCTGAAGGCAGTTGGAACGAAGCCAATTGTGGTGGAAACACAACAAAAAG
CACCTGGATCAATAACCCACACTTTGAACTGGTGCTTGAGCAGCGTGCCCGAATTTTTGCTTCCTTGAGTCAAGAAGACCCTCGCGGTAGCGAGAACCTG
AAGATTGTCCCTGTCGGCTTTCACATTTGTTCACTTAGTCAGGTCGTCAACGAAGCGAGCAAATTCGAGATCCGAGAACCAGCGAAGAAACTGGATGCAT
ACTATCGACTGTACAAACCTGCAGACCGCGAAAGCTTTCAGACTGGTAAACGACCAGAGAACCTTCCACCAGCGATTATACCTGGTACCGTGA