Description :
From Genome Similarity Track
Location :
Scaffold_5:644298- 645453
Transcript NameFunction/comments
Phyci_209904Hypothetical protein

Sequence
1155 bases(100 bases per row)
GGCGTCCAAGTAAGGACGTTAAAGGTGCAGGGGGCATCGGACGAAGTACAAGAAACAACGCTAAGTGGAAGTTTTGGTCAAGCAACACAAGAAAACTACT
GTTAAGCGTTTTTTACGATGATGGAATATCACGTGCATTTGTCCATGAGACGGTGGTGTTCGAAACATCGTATCCACGGCATTGGTTTAGTTCAGACGAG
CTAGGCGAATCTCGCGTCTCGAATCGCTGCTTGCGTCGCTAGAATTTCATCCAGTAAGCGATCCAGTTTTCTCTCGAGCGATGCCAGTCGAGATGCATCC
TGGTCGTCGACAAGTTCGTTTCCGGCAACAGAAAAGCTATCTCCACCACTTCGAACCGACGACACAAGCGTGGAATCATGCTCGTCTTCGTCACGGTTGG
CTTGGTTAACTCCTCGCTTCTGTGCTTGCTTGATTGCACTCTTGTTGATGACGACACCCTCATGAAGATATTGGAAAGTTGCGTCGAGTTGCTTCGCTGT
CAGCTTGGCCCCTGGAAAAGTCTCCACCAATGTTTGGGCTGTCAGCTTGGTGGGAGACCTGGTTCGCCGTCTGGTGGATTGGTACTCTAGTTCCATTTTG
GCTTGAAGCACATGAAGGAGCAGCGACGGGTTAACTTTCTTCCGGAGAATGACGTATTCCGTTGGAAGCTTGCGAATGTCCGCCTTGATCCGGTCAAAAA
TTACTTGAGCCTCGACGTCGTTATCAGGAGGTTTCGAGCTTGCAAGCGCACAGCGTGCGGGATTTCTCCCGTGCAGTTTGTCGAGGCAAAAGTCCGTGAT
CCTGCCGTTAAGCATCAAGCTGGCTTCTCCTTTGTAGCTCTCTTCTCGCACCACCGTGTACGCGTCGAGCACAATTGCCAACATCATATTCAGAAGCACG
AGGCTGACAACAATCATGAAGCACCAGTAGAAGATGTACGCGAACTGCAGATCTTTGATACTGTCGTAGTCAAACGTCCCAAAGAGCATGTTGATACATG
CTTGGGTAGTGAGAAGTCTCGTGGAGAACTCCTCAACGTCGGAGCCGAACAGGATGCTTCCAACGCAGACAAAAATTAAAAACGCAATGATCCACACCGC
AAAGAAGGCCGCAAATTGACGCAGCGCACTCGACATCGTTCGCGTGAAAATGCTC