Description :
From Genome Similarity Track
Location :
Scaffold_1214:6442- 8491
Transcript NameFunction/comments
Phyag_g9918hypothetical protein PHYSODRAFT_345449
Phyag_g9919conserved hypothetical protein
Phyag_g9920hypothetical protein PHYSODRAFT_492482

Sequence
2049 bases(100 bases per row)
GACGAGACCATCCAGGAGCAGCGCAACGTAGAGCAGGAGGCGCTCGCGTACTCCAAGAACGTCACCTCGCTGTACCAACGCGCGGCCAAGTGGAAGGCGG
AGCAGAAGCGCTTCCGCTCGACGTTGGACGTACGTCCCCCCAGTTTGATAGCCTCGTTAGGTGCAAGTCACTGACGGATACTTTTGTGCTGCAGGGGCTG
GATCGGTTTGCGGAGTGGGCTGCCGCCACGGAGAATGACCTGCACGCCATCGCTGGTAATCTGGAGTATGTGTCTgctgtgctggagaaggagcaggagg
gGGCAGCCAACGGCGGATATGCACGTGCGCAGGAGTCCACGTGAAATACCGTACAAGACACTGGTATGGTGGTGTTGCTCGAGCGAGGAAAGAGATTAAT
TAATACTTTACTGAAGCACGCAATAAGGTCATTGACGCCAATACCTGGTGGCACTTGCAGTCTCTacactgttgctgctggcagcggcCTAGAACGTGAT
GAGGCACAGGATCACGAGGCTGCCGACgatcagcaagaagcgagACAGGAAAGcttgctgcatttgctggcGCGCCTCCTGTGCTGTCAGTGGTGTCCCA
TCTTGATGGTGCGTGACGGGAGCAGGTGGCTGCTGTACAGCGTCGCATCCGGGGAAGCAGCAAGTGTCAACAATGTAAGTTCATGGTAGCATCGTTAAAC
GCACCAGGCTCAATCGCTAGCACGTACGTATGGCGCCCCGAAGAGCGCGGGGAAGAACCCAATGGTTGGCGACATTGAGAACGGATTGCCTTGTCCATTG
CTGTTAAAGATCCCGAACTGCCAGCACGTTGCACACAATTAAGCCGGACGTTAGCACGAATTATCACGTGCTGAAAGCCAATGCAGCTACACGCACATTA
TacggacgtcgtcgtcgaagctgctcagcGTCTGGTCGCTGTCCTCGAGGACGGTGGGGGATGCCGGTATCGGACACTTGCTGGTGGGTTCTGCACCAAC
ATAACAGAGTTATTCTTTAGCGAGGAGCTATTATAGTGAAGTCTTCCGTCATTAAAGCATCAGGACTCACCGCGGATCATTAGCTTCAGCACCGCGAGCG
TACACAGGGATCACGTTCTCCTCACTGATTCCAGCTTTGCACACAGGACACTCGGAGTGGTTTTGCATCCACTGCATAACGGAGTCAGCTACAGAGTAAT
AACAGACTCAGCTTCACTGCCAGCGTACCTGATACAGACACGGCCAACTGGGAGACAATACAGATCGAATGCGTgagagcaggaagagacGCACAGCGAT
GCAAATAATTGAGAAGATAGACGACGTACGCACCAGTAGAGATGGCCGCAGAGCGTCACCACGGGGCTGGACACCGTGTCCAGACACACATTGCACTCGA
AGAAGGGCATGCTGCTGTCCGTGGGCTCCGTCGTCCCGGTAGCCGACTCCATTTCGGGCACTAATTTCAAATCTGTAATTTTCAGATACTGCATTTATTC
CCGTTCATATTTGGACTGGCCTAGATTAGCTGATACCAAGAGCTTCGCAGCATCCTGGTCTTGCAACGAGCCAAAGGAAGAACTGCGAAGGCGACTTTCT
GCGTCtttggccagcaccatcttgctgttgcttggcGAAATCTTCAACGCCAATGGGGTCTGGTTGGAAGCGGCAGCGTGCAATGGCGTCGACAACGAAG
TCGGCATTGGCGCCATCGCCAGTGCCGACGAAGGGATCTGCACACCCAACGGAGACGAGCCCAGAATGGCACCACCTTgagtcttcgtcttctcaaCTGC
TGAAACACGGTAGACGGAATCCGCTACCACACCAGCAAGCGCCGACAAGTTcgtcgcgctgctgttgctcatCGTGGACTGCTGAATGCCTTCACTGCTT
TGGCCAACAGGCGTTGAAATTGCATCAGTAGCACCCTTAGGAGCCGAGTATTTCTTCATTCGGTCCAACTTACCATTGGCGTCCGGGTCTTCCATCACgg
cgcgctgcttctccttgagctctTCGATCTGCGCCGCGTACCTGGCCCT