Description :
From Genome Similarity Track
Location :
Scaffold_951:6440- 8893
Sequence
2453 bases(100 bases per row)
GGTTAAGGACCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTTATCATCATCAAGAAGAACGGGGTGGATATACGT
CTGTGCATTGATTACCGGCTAGTCAACGGCCTGACCCGATTGATGGTGTATCCAATGCCTCTAATCAATGAGCTATTGGAGGATTTGGATAAAGTACTCT
GGTACTGTTCGCTTGAAATGAATTAGTGGTTTCTGGGTGATGACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGACTGTTCG
AATGGAACCGGATGCCGTTTGGATTGAAGAATGCGCCCCAGATCTATCAACGCCTGATCGATAACGCCCTCTACGGATTCACCCGAATACCGGAACCCGA
AAGGGGTGGATCCGGGGAAGGCCATACGGAAGCGGATCCATTCGAAGCAGGAGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTAT
ATTGACGACATTCTAATCCCGGTAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGAACTAAGTGGAATCTCTCGATCAGTG
TGGTGAAGAGCGATTGGGGGATGCGCAAGGTGGATTATTTAGGTCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTGGC
AGACCTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTAAACTACTACAGTCGATTCATCGAGAATTACGCACTGTTTGCTGCG
GTACTCTATAAATTGAGAGAGGTATATTTTGCTGCGATGACCGCTTCAGCTGTCCGGATCAAACCCAACAAGCTCAGGCCCTGAAGATATCGGATCCACG
AAGGGATTCAAGTAGCAAGCCGCCCGAAGAGGACCTAAAACAGGAGCTGTATCCACCCCGGGATCAACGGAAAGAGGATCCAATTTGGATAGAGAACTCG
GAAAAGGTGGAGCCTCGGTGGATCCGAGCTCAGCACGCGTTCGTGGAGCTAAGGAACATGATCGCGACGACGCCCATCCTCCGCCATTTCGATCCGGAAC
GTCAACCTACGGTGATAGTTTATGCCGGTGACTGGGCAGTCTCAGCAGCCTTGGTACAAGAACATGAAGGGATCTGGCATCCGGTCACCTTCGTCAGCCG
AACGCTAAAGCCGAATGAGCTGAATTACGGAGCGGTGGAGAAGGAGATACTCGCACTCTTGCGGGTGTTGAATCTCAACTACAACCTGCTGGTGGGAAGA
TTCATCCGGATCTTGACTCGACACTCTACGCTCGCTTGGTTGTTCAAGTCGGCCGGTCTACAAGGGCGGTGGGGACAATGGGCAGCTTTACTTTCACCTT
GGACACTGGAGATCGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTGCTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTAAC
TAGGATCGCTCCTAAGAAAGAGCCCTAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCC
GCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGAAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCA
CCGTCAATGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAACCTGGT
GATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCTCTAACGCTGTTACGGCAGAAGGTGATGGTCCACCTGCGTGGTTGGATGGATCACGAG
TTGGTACATGTCAAGCAAGATTGGAATGCCAGTGCAGATAGTTTGGCCAGTGCCGCTTTACGGAATCAATGTAGTGTCGAGGTGGAGAGAGAGACCGAGC
GTCAGGATCTCGTCACGCTAAACCGACTAGACGAAGTGGTGGTGGTCGGATCCGGGAAAAGGACAGTCCAGGTAATGGCTGTCACTAGATCCAGAGGGAA
GATTGGATCCAACCCCCAAATTGTCGATGAAGCATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAGCGAAGAAGCGTGGATCTTGGGA
CTGGAGAAGTATCTGATTGGGGATGTACGAGACTTAAGTCGGGAGAATGCCAAATCCTACAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACT
TGCTCTTCTATTGCCCCCTACGAAGAGAGTCCACGAGGATCGGGATGGATTGATGAGATTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACTCCAC
TATCACGCTAGCTTGGAAGGCGGACATCAGGGAATTGGTCGGACCTACCAACG