Description :
From Genome Similarity Track
Location :
Scaffold_2485:644- 1758
Sequence
1114 bases(100 bases per row)
GGCTACAGCTTTTAAAAGCATAAATAACATCAAACAGTGTCATCGGTAGCGTACGCATCATATTTGCAGTAAGTGTGCAGGCTCTCGTCGTTGGGGTTAT
TTTTCTCCTTAGAGGCTCATCGAGTTGTCTCGTTTGGAAGTTTATAATTTTATTTTTACTTCGCAAGCGCTAGCGATAGATTTTGCAAACTATCGAATTC
ATTGTCGATGAAATTGATGCAGTAAAACTATAGTTTGCTTTCTGTAGACAGAGGCTTCTGTAGGCTTGTCTTGTAGTCATAAAGTGTTGAATTTTTTTTT
CTCATTCTTTTGGTACTGTTATGCTGAAAATGTTTGAAACTTTTGCCAGTGACAATAAATGTTAAAGTTTGGCGAATGCATGAAATGTTTTTGAAATTGA
TGCCTCCCAGTTTCATACATTTCATTAAGTATTTCTCTCTTAACGTTTGGTTTTTTTTTTTTTCTTCGTACAAGCTAGGCAGTCTTTGTGAGATTTGCAC
TTTTGTATTTGCATCATGCAAATTGCATATTTGTTTTTGCTCGGAGATCGTCCTTCCAAGTCTTCGGCATCGAGTGGAACAGGTACAGTGATTTCTGACC
GTCAGTCAAGGGAGACTCGGTTGCTTCAGACGCGGCTTTCATCGCGTTTTCCAGCTCAAGGAAGAAGCTAGTCAGATCACCACCTTCTTCGTACTTGATC
TCCATAAGGAAATGCTGGATGAAGTAGGGGTCGCCATGAAAGGCCGCACCCTCATACTGGGTACAGATGGCCTGGAAGATGTCGAAGGCCGTTGACAGAT
TCTTGACAATACGGATATGAGTATCATCCATCGTCTTCATCAGGAACGCCTTGGTTTGTGCCTCCATACGGCGAAGGTGACGAGCAGATGGTAGAGACGT
CTTACGCCGCTTAACTTGCTCCCGGTCACGGCTGACGTGGCGTTCCGCAAACGGCCGAACTGTTGGTAGATCAGCACGCTTTGTTTTCTTGGACGATGGA
GTATCGTCGTCGTCGCGGGGCTGCAGCTCATCCGAGCTGTCCTCGAAGTCGACCTCATCCGAGTCAATACCAGCCGGAGAGCTGGGCTTGGAGGGATCGT
CGTCGTCGTCCGAC