Description :
From Genome Similarity Track
Location :
scaffold_965:644- 1707
Transcript NameFunction/comments
Pl_101724hypothetical protein PHYSODRAFT_544256

Sequence
1063 bases(100 bases per row)
ATTCGACACATCGAGATGTCAATAAGTGCAACAACTGCATTCTTAACATGAAACTGCGTGTAAGCGTTCCTAGAGTCATCTTCAACGCGGACTCTATTAG
ATAGTAATGCAGCGACAATGACACGCCTAGATAGAGCTGATGGAGAGGTGACCAACTTCATCGACAAGGCCTACTCAATTTCAGTCTCGATGGGCACAGC
TTCACGTCCGTACTAGTGTCCAAATCAACGTGCGCTTAGCTTCAAGCACCCACGCGATAGCTATCTCATCACAGTAGACGAGTCCTCAGCAAATGTCGAG
TCCCAAGTTCAGCTCCATGGTATGCCGCGATTCGACCGTGATTCAGTTTCCACCCAGTTACCTCCCAACGTCAAGGCAGGCATCAAGTTGATGCCACTCC
CGAGATTAGAGGGGCACCAGTCCAATCTGTGTCTCGTTGATGATTGGCATCAGATGGCTGCACCACTTCAAGGTGTCATTGCTGCAGCTGGGGGTTAGCT
TGATTCGTGTCAGAGCAGGAGCGTGGGCAGGTTACTGCCCTTGTCGGTGTGCTCCATGACATTTCATCACCAAGTGCAACCTGAAGCATGATTCTTCATT
ACCACATCCTGATGGCGTCTTGCTGTCCGAGAAGGATCATTCAGCTAGATCACTTTACAATTTGCTTCGGGTTTCGAACTCCATCGTTTCAAGCTCAAGT
TCAAGAATGTCGGCGTTAATCCGCTTCGCATTGTTGATGCTGGCCGTGATACTTGCACCCTCTTCAACACATGCAACCAACAAGTACCCGATCATCCTCG
TAAATGGTTTCTCCGGTTGGGGTCGTGACGAATTGTTGGGGTTCCGGTATTGGGGTGGCATCCAAGGCGACTTCCAGGACGAACTCACTGCACAAGGTTA
CACGGTCTACACTGCGGCAGTAGGTCCATTCTCAAGTAACTGGGACCGTGCCTGCGAGCTCTACACCATCATCAAAGGCGGTCGAGTTGACTACGGCCAG
AAGCACTCGGCTACTCACAATCACCTACGTTACGGACGCAATTATACCCGAAATGGGGCACGA