Description :
From Genome Similarity Track
Location :
Scaffold_144:644- 1657
Transcript NameFunction/comments
Phyke_g5006conserved hypothetical protein

Sequence
1013 bases(100 bases per row)
CATACTCAGCTCACACGCTTCGCTGCACTGCCAGACGCCGAGATTGTGGAGCTCCTACGCGTATTAGCCGAGTTCCTCATATATTCAGACCAGCACCGAG
TGtctgtggagctggaggaccAGCACCaggctgaagaaggaggcgacCCCGGAGCTTTCTTTGACTACTTTGGAGAGACCAATATGTTGGCGCTACTGGT
GGAATTAGGGGCCAGTCAGCCCAGTGTCCCTGTGCAggtccagctgctgcagactaTGAGCATTTTGGTGCAAAATATCACGACGCGGACGTCGTTGTAC
TATATTTTGAGCAACAATCATGTTAACAGATTGCTGGAGTGTCCCTTTGAACtggacgaagatgatgatgtACGAGATTGGTATGTGACGTTGCTGAAGG
CCTTGTCGCTGAGGCTGAATGAGGAGACGGTGCAGTTCTTTTTGGACACACAGCAAGGAGAACACTTTAGCTTTCCGCTGTATGCACGTGCGTTGCGCTT
TGGACGCTGCAATGAAACGATGGTGAAAGTGGCGGTGAAGACACTTACGTTGAATGTTTTGAAAGTTTCTGATGCGAGGGTGAGAAGTTTCGTACTGCAG
TATGACGACCTGAACTACTTTCGAGACATTGTAGAGATCGCCAACGACCTGACACTTCGGCTGCAGGGACTATTGAATGTCTGGCCAACTTCTGAGGACG
AAACAGAGCGCACGATGGAAACAGAGAAACTGGAAGAGACCATAGACGCATATATAGATCACTGCTTTTACCTGCAAGACTTGCTGGATGTGAACGTTCC
CGAGCTTTGTTACAAGATCGGAGATCTGCTCTTCTCTCGGCATATCAAACGCTTGTTAGCTACAAGTATACTGCCAGACTGCGGACCCCCACCGCAACGA
GTATCGACACAGCTCGCTTTGTACCTACTCACTCGTCTTATGGGTATCCTGGAACACACACCCCTCGTAAATGCGATGGCTTTTATGCTGCTATCGCCAG
ATGCGGCAGAAGA