Description :
From Genome Similarity Track
Location :
Scaffold_72:64399- 65649
Transcript NameFunction/comments
Hyaar_Emoy2807971hypothetical protein

Sequence
1250 bases(100 bases per row)
GCTCGCATCAGACTGCGCAGCAATTCCGTATACTTGATCTCGCGGAGAAATCGAACTCTAGTGTAGTCAATGGATCGGCTCGTAGAATCCGAGGATTCTA
TGATGGCTGCTGCACCAACGCCGTTGCGGTGCTTCTTGTGCTTTGTCTTCGACTTCTTTGACGACTTGCTCGCCACAGCGCCAGCTTGCGGTGTCGGAGG
TGCGACAATCTGTCTACACTGCTCGGTTGCTGGGCGTTGCCCCATCTTCTCCACAAAGGTCCATGTAACATTCAGATTTTGGAGACGTGAACCTTCCAAG
TAATCCAGATACCTGTTCCCGACGGAATCATAGATCAGTGAAAACGAACATCCGCCGCGAACAATGCAGTGCAACCACGTACCAGTATGCTGTTCCGAAC
TCTGAAGGCGCATATAATCCCAGCTCTAGCCCCAACACCACGTATTGGTTCATCAAATGCACTGATTCTTCAAGAGTCCAAGCTGTAAAGTATCGCGGAT
TTGCAGCTTTCTGCGCAACATTCAGCGAAAGTACGTTCATTGAATACACACGAGTCAATCAGAACACAAGCGTACCGGTATGTTCATCTCGGTCGTAAAT
CTTTCGTCTACGGCAGCAGCGTCGGCCTGAAGTATGCTCCACTCGCCCAATAAATATTCGATTCGCGCACGCTGTCGCGATCGGTTGTGCAAAAAGACTT
TGAGCGACTCGTACACAGCTTCAATGCACCGCGACGAATACAGCACGCCCTCTTGCGTCGAGAGCAATACGGATGGAACTCCATTCATCACCATCGCTGC
CGACAGCCAATCCATGAAGTTGTATTCGCCATAAATTTTGCTGTCAGCGTACAGGAAGAGCTAGATTAGAATTAAAACAAGTCAAATGTAAGACAATTGG
CAGTACAAAGACGTCATTCGAAAGCACTTACCAATACATAAGAACGGGCAATGACTGACGGTTGCTGCCGGGAAAACTCGATCAAAAAAATGCGTAGGTC
TTCCATGCACTTCCATCCAGTAGGAGAGCAGCTAACTACCAATTCACCCAGCACTTCTTTCATCTGACTCAAGGCCTCGTCGATCGAAGGCACCTTGATA
TCGCGCAGTGGTGTACCGAAGAGAAGAAAGCGGCTGATACTCGAATCAAAGCCAATCGGCTTTCCACTAAAGCACTCCACATCGAGCTCGAGTCTCTCGG
TAGACAATTCCTCGACCAACTCGAAGGCGCGATGAAAACCATCTCTGGCA