Description :
From Genome Similarity Track
Location :
Scaffold_70:64391- 73143
Transcript NameFunction/comments
Phyci_231980Hypothetical protein
Phyci_231943conserved hypothetical protein
Phyci_521529Hypothetical protein
Phyci_82426hypothetical protein PITG_16803
Phyci_94497Hypothetical protein

Sequence
8752 bases(100 bases per row)
ATTCAGAAGATTATGTGGCAGTGCTGTCCTTCAGGATCGGTGAGTTGCTGGACTGCGTCAGGCAACACGCCACCGTATGCATTGACGGGATCGAAATTAT
TTTCTTGTATCTCCCTGTGAACGATCATGATCATTAGCAAAACCTGCAGAGCGAGTGAGCAGAAGATTTTGAGTACTCACAGGAATTCGAGCATCGTCAG
TTCTGCTATAGACGCCGGAACGGGCCCGATAAAGTAATTGCGATCAAGACGCAGTGTGCGCAGCGCTGTGAGTGTCGATACTGTATCAGGCACGTAGCCC
GTTAAAAAGTTGGAGCTGAGGTCTCTGCACAAAGTGAACTCGATTAGCTTTCAACAACGAGGAGTACGGCTTCGGGAAGACTTGAACGCACAACTCCTGC
AAACCGCTGAGGTCCTTGCGAGGGAATTCAGGCGGTAGAACGCCCACGAGGTTGTTATTAGCGAGTCGGCTGCCACGAATGGTGAAAGCAACATCAAATG
GTCATTCCGAAGTTCCCCCGTGCAGCCTCAACTTCACTTACATGCACCGGATGCGGCCGTAGCGATCGCATACGATGCCGTACCACTACTCCAGCGCCAC
TAGTTATTAGAAAAATGCCAACAGCAAGCAAGGAATAAGCCAGACGCAAGCGTACACTGTCGAGACAAGGGTCGCTGTTCTCGTTCTGGATGTCCCATTG
CGCAGCCCAGCGCTGGCCGTGGGTGGCCCAGTAGAGCAGCTTGAGTGCGCCGCGCTCGTTCCGCGTAATTGCCATGGCGCGACATGCCCACGACAGGAGC
ACAGCTGCGACAACCAAACCAAGCCGGCAGCGCTGCATCATTTCAACGACTTCAACAAGTGCAACGCGTATGTAGCCATCTCCAAAAATGGCTGCAATTA
GACCTCGTACTTATCACAAAGCACCACCATCAATCATACATATTCTGTACCACAGTTATTTGTTCACAAACACATTCGATCGCCGAGGAGCGCGTGCGCG
GCCGAGATGCTGCTGGAGAAGCCCGAGGACGTCAAGCACGAGAACGCGTCGGGCACCGGTGCGTTTGCCTCCTGTAGTAGAAACGTCCGTTCAGCTGCTG
CCGCTTTCTCGAGGCTCTAACTCGCTCTGGCTGCCTCGTTATCACGCGTCGAACAACAGTGTGCGCCATCTACGGCGTGGACGCGCACCCGACGCTGCAG
CTGTTCGCGACCGCCGGCGGGGACAACAGCGTCAAGATCTGGTCGTTGCAGCCGCCGGCCGAGGGCGGCATCGCCACCTTCGAGCTGCTGGCCACACTGG
CCAACCACCAACAGGCCGTCAACTGCGTGCGCTGGGCGGGCCACGGCCGCTACTTGGCCTCGGGCTCGGATGACCAACTGGTGCTGCTGTACGAGCTGCA
GGCAGGCGCACCGGCGCCCGTCCCCTTCGGCTCCAACGCCAGGCCCAATAAGCAGAACTGGGTGCGCTGCTCCACGCTCGAACGCCACACGATGGGTGAG
CATAGGCAGCAGTTGAAATGAGGTGGACTGAGGAGGCACCTTCTGACGCTTCTTGAGTGCTGTTGCTGCAGATGTGGCGGACGTGGCCTGGTCGCCCGAC
GATCGCATGCTGGCGACGTGCAGCATCGACAACACCATCTTGATCTGGGACGTGGGCGTCGGCGCTGTGAGCGAGGTCATGACGCAGCCGCTGCAGACGC
TCACGGGCCACAACGGATGGGTCAAGGGCGTCGCGTGGGACCCCGTCGGCAAGGTGCGTTCGGGCTAGAATAGGGTTCTTGTGGGTCGATCTGACGGAAT
GTGGGTGCTGGCTGATGCAGTACCTGTCGAGTGCTGGAGAGGACAAGACGGTGCGGATGTGGAAGGTGGCCGACTGGCAGGAGTCCGACGTCGTGACCGA
ACCGTTCGAGGGATGTGCCTCTACGTCACACTTCCGCCGACTGGCATGGTCGCCGGATGGCTCCGTCCTCTGTGCTACGCACGCTTTCAGTTCCAAGAAA
AACATCGCAGCACTGCTAAACCGCGGGTCGTGGACAAACGACCTGAAATTTGTGGGCCACCAGGGTGTTGTCACAAGCGCGCGATTCAACCCGAAGCTCC
TCGGTAAGGCGGTGTGCAGCTTGTTTCCGATCACGTTGGTGCTAACGTTCGCTGTTTTTCCTTTCCTAGTGACCAAGGCAGACCCAGACAAGGAGTTCGC
TTGTTGTGCGGTGGGTGGTGAGGACGCGACTGTAAGCATCTGGCTGGCACATCTAGCGCGCCCTTTAGCTGTCATCAAGGACTGCTTCGACTCGTCGGTC
ACGGACCTAACCTGGTCCAGCTCTCAGTCGCTCCTGCTAGCCTGTTCCCTTGATGGGTCAATTTGCTGCTTTCAGTTCGGAGGAGACGAGATTGGGACTC
CCATCTCTGACGCGCAGCAGAGTAAGCTGTTACAAGCGAAGGTAAGCAGTTGAAACCCCGTTTGTGATGTAAACTCTGAGTTGTCTACTGACGCGATCGC
TGCTTTGGGCTGTACTTAGTATGGATCTCGAGCTGGAATTACACTTGCGTCGACATTAGTAGAAAATCCTATTCAACTTCAGGTACATGCAACCTTGCCG
ATATTATTGAGCCAGTTAGTATGAGGCGATACTTAGTGTCTGACAAAATATGTATTCTGTTAGCTTGAAGAAAAGTCGACGACTTCACCGCGCTTGGCGG
TCAGCCGAAATGTTAGCACTGCAGTTGCACCGACAGTGACTCACACAACGAACACCCTTATTCCCAAGAAAAAGAAAAAGCTAGATACCCAAGCATCCGG
TATGCCACAAAGCAGGCCGCCCTCTGGAGCAAACAAAAACGACAAGAAGCGAATCGCCCCAGTACTCCTTCAAGAAGACGCACAACCTTCGCAAAACAAC
AACTCAGCCTCATCGCAGAACAATATTCGCAACATCCTTGGGCCAACCATCATATCTCCGAAAGCGTCGGATGTTACACTATTGGATTCTCGCATGGCTT
CAACCAATGGGAAGGACGTTAGCATTGTGCCGGAGACAAACAATTCTGCTACACTCAAATCGAGCTCTACATCTGTTCAAGGCGAGAAGACAGCGGCCAC
CATGAAGGAGAAGTCTGCTGTGGCAGCGGCCAACGATGCACCGTCGAAGTTGTTAAAGACTGACTCGAAAAAGAACGGAGTAGATGGTCATTCTTTGAAG
AGGAAAAGAGAAAGCGATCGGCCACCAACTCAAGCTGCTATCGTGGTAGCTAAGTCGAGGGAAGTGGTAGCGCGAGCGCCAAAACTGCTGAACGAAAGGT
TGGTCTACTTATCTATGTTTGTGGGGGACCGATTTCAAACTCATGTCATGCGTTTATTATCATATTCTGATCAAGCAGCAGCGCTGGTGTAGCAAATGGC
GATCAATTACTACCCGAATTTCCTTTCCGTTTGCAGTTCTCGGTTGAAATCGACATGGACACACAGTCGAACACTTTGCGCAAAACCTCGAATGGCAAAG
GAAGCAGTGGAGTGGCATCTTCTAAGGTGGTGGTGGAGGTTACTGTTCACAACCTGAAAAATCCTCAGCCAGAGGAAATCATAGGTGAGCTGGGAGTTGT
GGAAGTGCATGATTGTTGCGCACATGATCTGACAGTTTTGCACAAAATGCCACAGAGTTAGGCCCTGTTTATTCAACGATCCAATGCTCAGAAGGGAGCG
AAGTCAGGTGGATTGACCGCATTCCTGGCCGGGCCGTGTGTGCTGTGGGGAACGCGAGTTATTGTGCGATTGGTGTTCATAATGGAGATCTTCTTGTCCT
CAATAGCAGTGGACGGCGGTTGTTTCCTTGCATAGGTACGTTTGTACGCAAAACCCTACGATATTATTCGGATACTGATACTCATTGTGTTCTTCCACAG
CTTTGGGCAGTTCTATCTCAGTGATGGAGTGCAGTGTAAATGAGTCACCATACCTACTGGTAATTCTAGCTACGGGCGACTTGAAAATCTGGGATCTAGC
TGAGCGCAAGCTTTTGCTTGCTAGCTCGATTGAGGCGATTACGAATGTGAGTCGGTTCGTTGCAATGTCATTCAAAACGGTGATTTTTCTGACCTTTCTT
CATTCTTCTTTCATAGGTGACACCAGAAGATAATCGCAAGCTGACCCTACTTCGGTGCCAAGTGACAACGAGAGGGATGCCGCTTATCACGTTTGCTGAG
TCGAACTCCGAAACCAAGGGCAGTTCTAGTCTGCTTTCGTACACATTTGACACGGCGATGTCTTGCTGGTACGGGTTTTGCATTCATAGTGTGGGTTGGG
CTGCAGAGCTAATATTTTTTATTCGTTTAGGATGCGAGTGGCAGACGACAGCTTCGTATTTTCGGACTTTGCTTCTGCTCTGTCGACAGATGCTGTGTCA
GTCAAAAGTGTTCCTGTACGTGTGCATTTCACTGCTCGAGAGAGATTTTCCATAAGAGGCGCTAAGCTCTTACATGTTGCGTGTGTACGGCAGATTGGAC
CACTGCGGCGCCTTCAAAATGCCTCTGGCTATGGCCGAACGCAACGAGGAATCGCTTCGGCCATGCTTTCGGGAATGTCGGACCCCTTGATGCAGCGCAA
CGTGACGCGCTCGCACCTCGAGCACCAGGTCGCTGCCGCCGTCATCCTGAAAAGCTCGGCTGAGTATCGCTACTGGTACGTCAGCGTCGTGAATCATATG
AGCTCGACAATGTGCATGCTAACGGTTTCTGAAAATGTATCGCGGTCACCCTACAGGATTCAGGCGTATGCGAGGTTCTTGACGCACGACGAGGACGTGG
CACGGCTTGATGATCTGTGCGCTGAAATGATGGGGCCCTTCCACGCGTACGTGTTTGTTTGCCCTGCATAGGGGATTGTCGTGCCAAGCTGACCATCGTG
CCTCTCGAGCTGCAGCCCGTCAACCCGCGACGGCACTGCCGCAAAACAAGAAGAAGACAGCGCGTGGGACCCGATGGTTCTAGTATGTGAACTCTCATTT
ATTTTTCAATGGCCGAACTGCTTGGTATTGCGCTGCCACAACTGACAACCGGATTGGTTGCAGGACCTCGTGAAACGGGACGTGTTGAAGTCGCACATCC
TGCCGACGATCGCGGCGAATCGCGCGTTGCAGCGCGTCGTGACCAAGTACCAGCTCATGCTGAGCGAGATCGAGGCCCGCGAGAAGgacgaagacggcga
ggaaggtgacgacgacgacgatgacgaGTCGTGAGCTCAAGCTTGGTAGGAGCAGCTCCGCGTAGACCTGATGAATAGAAGAGGCCGCCTTACCCCGCCC
GCGTCTTCGTGCACTGTTCAGCGCACACGACTAGCGGCACCGCCGTGCCTCGAATGCCAGTTCCGTTCAGTTTCGGCCGCTGGTCCGCCCCGCGCTCGGA
TTAGAGGCCGGAAGGTGCGTTTCGCCTAATGCGGCGGGCACCCATGAggccgcggcggcggcgcggcggcACTCTGGCTCGCCCTGTCGAGTCGGGCGTC
TCGGTGCAGCACGAGGCGGCTCTGGCAGTCGACGCGAGGTACTTCTCGATCTGCGCCCGCTCTCGGCTTGTCTTATCTGGTCCTTCATGTGGCAGGATGA
CGAGTGAGGCAGTGCTGTACACGACCGTTGCTGCGGTGTACCGCCATCGACAAGACCACGTGCTAACTGAGCCCGATGCGCTTGTAGTGCCCGCAGCTGT
TCTTGAAGCGGGGCGAAGCCGCAGGATCCAGCCTCCGTGCACCTGGCAGCCCATTTCGTATGGAGCTTGGGCGCAAGTCCACATTTGCGTGGAGATCGAC
CCGCAGACGTCCGAGGCGTGCTTTCGTATCGTAGTCTGGCTTCTGGAGTCGGGCACCGTCATCGTGAACGACATCCTTGGAGCCGGGTGCCGCTGGTGGC
GTAGTGCTTGCGACGATGCGGCCTTCCGGCGGCTCTCGGGTGTGGACTGCCACACCTACGGCTTCCACTTCCGCTCTGTTGCAAAGGCTACCGAGTGCTC
ACGCATCGTTAACCATATTCTTGCCAACGTCCCCGGTTCGAATGCATGCTTTATCTGTTTTGCAGTCCACATAGTGATACGATCGTTGACTTCGATGCGC
GCGTATACGTGCAGGGGTATTGAAGGTCGTGAAGAAGCTCATGCGCGCGAATATCGACCTGCAAGGCGTACGTTTTCGGTTTGTCAGGTTGCTTCACCGT
TTCAATTACTGCGTTCGACTGAGCGTGTTACAGCTCGTTATGGCGTGGCAAGGTCTAGGACTACACTCGATCCATTACCCAGCGCGAATACCCCGTATTT
ATTCCGAAACCACGCCTTCCTCTTCGTCGTCGCCGCGCATTGCAGATTTGAGCCCTGACCGCACAATATATCCGAAGAAGGGAGAGGCTAGTTCACTACC
CCGTGAAGCACAGCAGCAGCACCAAGAAGAAGAATTGGCATCGAGCGACTATGACCGAGCTGTCTTGGAGGACTTAAAGACCTGCAAAGCGGCTGCAGGA
CTGGAAAACCTTTCTTCTGGGATGAGGGAGGAACACAGCAACCATGTAGACGAGGAGTTTGGCAGAATGGCTACGTCTCCCGTCGCTCTGCTCGAGACTG
CCGGAGGCTTCAATCTGGACCCCCCGTTTCCTGTAGCAAAGCGCTCACGTGGAGAGTGGATCAGTCGTCCATACAAGATGCGTGAAGAAACCCACGTGAC
GTACAACGCGGAGTTTGCACGGTTTGAAGGACTTCCGGACGAGTGGCGTGAATTGAACCAACAGTTTGGTTTACCTCTTGAGGTGGTGCTCAAACGAGAG
GTAGATGGATACGATTTCAAACTCCCGGCCGTGCTAGTAATGATGAAAACCTGCTTTCTAGCGCACAATGGGGCACGGACAGAAGGCGTGTTTCGCCTGG
CCCCAGACAAACAGGAATACACCGTTGTAAAGCAGTCCATCAACGATGGCACCTTCACGGACTGCGCCGACGTTCACATCATGGCGTCCCTTATCAAGGC
ATAGGCTTCTGTACACAGCTATTGTGCTCCAACTCAACCAAACTAACTGCTTCTTATGCTACCTAGGTTTGGTTTCGAGAACTGCCCGTGAGTCTATTCA
ACATGCTCCCAGATGATCAAATTGCTCGTACCTGCGAACTTGTGGTAAGAAGAGAAATCCGATGTCTAGATCGTGGATCGTGTTACTGAAAGCGGTATGC
TGCCTAGGATCCAGAACCCAAGGTTGTACTCGAGAGTCTGGCAGCTTTGCCAGCACTGCACCAGTCCGTTGTGCTGTGGCTGCTAGATCTGCTGAATGAA
GTCGTCAAGTTTGAGCACCAGAACAAGATGACGGCAAAGAGCATGGGTGCGGCTTCCTCCCGTTTTCACGGTAGCCTCGGAGCCTGCAGCTAAATGTGTT
GCTTTCGTGTTGCAGCAATCGTGATGGCACCAAACTTGCTCAGCGTCAAGAACGCCGATGCTGGTGTCGTTGTCGCAGCCTACCGACAAGTGGCCGACTT
CATGCAGATTCTACTTCGTGCGCGGCAGGCCCAGCGCTCGGGTGAGATGACACACACTATCCGTAGCTAGCAACGTTGGCAGGCGAGAGCGCAAGTCGTT
TTTTATTGATATCGATCGGAATAATTTAAAGCTCGTACAATGACGGCGTGACGCCGGTAGCAAAATGCAAAAAGGAAGCAGCAAGCAAAAAACCCAATGA
GACCGCAGAGAGGACGAGGCTGACTGTCGACACATCTATCCGAGCAGAGGCCCTCGTCTACACGAGGCAGCCGTACTCCGGGGAGATGTGGCGGAAGATA
TCGTCCTCAAGGCCCTCGAGGCCGCTGGGAGCGGTGGAGGCGGAGGGCTCTTCTGCGTTGGGGACGGCCGCAGCCATTGTCTGCTGCGCCATGGCGGTGG
CTTTCCGCATGGCCATGGTGGGGGACGGCTGCAGCGGGAAGAAGTCGTACGAGACGGCGTCCAGCGAGTAGCCGCAGGATGGGTGGTCGTTCTCACCGTA
CGGGTCCATGGTGGAGGTGCTGAGCTCGCCGAAGGGGTCGTACAGTGAGTCGAAGACGAACCCCGCCTGCGCGGGGATCATGGCGGCCTGGCCGCCGTAT
TGATTGTAGTGCTGCGCGCGCGCGTAGTCCGCGGCCGCGCTCATGGCGGCGGCGTTGCCGAAGAAGAGGTTGTCGCGGTGCGGCGACGAGGCGGAGGCCG
AGGACGGCGAGTCCGTGAAGAGGTGCTTGCGCGCCTTGTTCCTGTGCACGAAGTGCTCGAGGCCGGGCCGCGGGCTCTGGGAGCCGCACGAGTCCTCGTC
CGAGTCGTGGTCGTCGGGCGTGTTGCCGCCGTCGGCGTCGGCCTGGAAGAAGTGGGCGGGCAGCAGCTGGCCGAAGGGGTCGATGCCGTAGGTCTCGGGC
GACAGGAGGCGCTTGAGCTGGCTCTGGTAGCCGGCGAACTGGCGCAGCTGCTTGTCCGAGAGCGGTGGGCCGGAGCCGTCCTGCGCCTGCTGCTGGCACT
GCTCGAGCTCCTGCAGCGAGCGCTTGAGGCTGCGCACCTTGCGGTACGGCCAGTGGCGGATGCCGATGGCGCGGCAGCGCTTCTTGAAGGCGGTGGCGCG
CACGCCGAACTTCTCGGCCGCCACCTTGAGCGGCAGGTGGAAGTGGCGGCTCAGCGCCGCGAAGTTGCACGTGGCCACGGGCAGCGGGCCCTCGGTGGCG
TCGTCCGAGGCCTCGGGCGAGTCGCAGGCCGCGCGCTTCTTGAAGTTGTGGG