Description :
From Genome Similarity Track
Location :
Scaffold_93:64377- 66811
Transcript NameFunction/comments
g12416.t1hypothetical protein
g12417.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae

Sequence
2434 bases(100 bases per row)
GCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTAC
ACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTG
AGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAG
GACGACTACACCCTCGTCGTCCTTGTTGGACGACGTGAAGGCCGCATACACACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCT
GACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACG
CAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGAC
ATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCG
CCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGC
GGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTT
TGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTT
CTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACG
CGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAA
TGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCAC
GCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACAACAAGACAGTGTCTACGACGGGCGTAGACACTTTAA
ACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCG
ACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCACCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGAGGAAACACAAATGAATTT
AAAATGGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCAT
TCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCACTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCAGCAGC
ACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAGACGCCAGAGAGTCTCGTCCCGACCTCGACCTTTACGTTC
GAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCAAACTGCGACGCTTGGAGACGCTCAACAGCCTCCA
AGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCCCCCCCCCGCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCC
AGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCATTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAA
TGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGC
CTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACAT
GAACGTGTACCCGTTGACGTCCCGCTCGGTGATG