Description :
From Genome Similarity Track
Location :
Scaffold_70:6435- 13248
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_70-abinit-gene-0.83Ankyrin repeat-rich vertebrate

Sequence
6813 bases(100 bases per row)
CGTCCGCCTCGAGCGCCTGGGCCATCGCCAGCTCCTGCTGCTTGGCCGCTGCGTTGCCCCGAAGCAGGTCCCCCACCACGCCAACCGGCAGCTTGGACAC
GCTCGCGGGGATGTTGGCCGCCGCGGCCGCGGCTGCAGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCGTGTCGGCGTTCATATCGCGCAGGTTCTTGAGCATGTTGAGCGAGCTGAAGTACGAGAGCGACATGGACATAAACTGGAACTTCATGAG
CTCCTCGGTGGACTCGAACATGGCCTGCGACCGCGCCTCGTGCTCGCGCGCCTTGACTGCGGTCGCCGCCGCCGCCGCCGCCGAGGTAGCCGTGGCCGTC
TCGAGCTCGATACCCTTCTCGCGCAGCCGCTCGAGCTCGAGCTTCTGCTCCTCGAGCAGCTCCATCAGGTTGCGCTGCAGCCGCGCGAGCTCGCGGTCCT
TGCGCTGTCTCGTCGCCTCCATGTCGGCGAGCTGCTCCTCGAGCCTGGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGCTTGGCCTGCACCTC
GCCGAAGGCGCCTGCGAACGCCGCCTCCAGGTCGCGCTTCCTCCGCTCGCGCTCGGACTTTTTGATCTGCACCGCCATCTCGAGCGCGGCCGCGTCCGCC
TGCCGCTGCCTCGCCGCCGCCGGCGACTCGAACACTTCGGCCGCCTCGCGGTCGTACACTGGGACGCCGTCGCCCAGAGGCTGAGCCCCACTACTGGCAC
TGCCTTGCACTGTTCTCGAGCCGAACGCGCCAACTCCGCCGCGCTTCAGCGCCTCGGCTTCATGGGTCAGCTCGCGCAGGTCGGCGTCGAGCTGGTCGAT
CTCGGCCAGCTCGCGCTCGAGCCCCGCCAGCTCCTGCTCGGACGCCTGCAGGTCCGCGTGCACGGCGCTCACCTGCCGCTCGGCCGCCTCCTGCNNNNNN
NNNNNNNNNNNNCCGCTCGAACGCCTGCTTGGACCCGTCGAGCAGCTGCAGGCCGAGTGCCAAGCGCTCCGGTCCCGGTGCCGCCGCCTGCCATTGCTGT
CGTCGCGTGGCGTCCCGCCGACCGACGTGGCCGCGGTACACGCGCTGGATCTCCGTGGCGGCCAGNNNNNNNNNNACCGCGCGCGGAGGAACTCGTCGCG
AGCCACGTGCATCCTCCATGTCGCCTGAAGGCGGGCCGCGGCCGCGTCTTGGTGACCGCGAACGACTTGCTCGGCGCGCAGCCTTCGACAGCGACGACGT
CCGGCGTGGCCGCGGAACACGCGCTGGATGATCCCAGCCTTGGCGGCGCGCAGCCTGCGTCGGAACCGCACGCGGCACGAGAACCCGCGGAAGAGCCTCT
GGATGGCCACAGCCGCGCTCGATCGATGCTCCGACGTCGAACGGAACTCGCGATGCCGCACGAAGCGCCGGCGACCGAGGAACCCGCGCGCGACCCGCAC
GATCTCGCTGCCGGCGAGCTGGCGGATCGCCTTCTGCTGCCGGCGCTCGCGCAGAGCCCCCACGCGCCGCATGGCCAGCCATCGGCGAACTTGAGCCTGG
ATCCGAACTGCTTGGGTGGCTCGACGGCGCTCGAGCTCCTGACGCATCGACGACTCGTGAGCGCGAACGCCGGTCGCGAACGTGCGCTGAGTCTCGGCCT
TGACAGCAGCGAACTCGTCGGCCCGCAGTGAACCAACGACTCGCTTCCGCGCTCGCTCCTCGGCCTCCATCTGGTCGAACAGACTCGGCAGTCCCGGCGA
GGCTGCGACGTCACTGCGAACTGCCGCCACGGACGCTGGGACGAGATCGGACGACAGGAGAGGAGTCGCAGACGACTCGAGCACCGTCGGAGTCACAGCA
GCGACTGGAATCGGCTTCGGTTGCGAGCCAACCGCTGCCAAATCGCGCTCGAGTCGCGCCTGGTCTCGCCGCTGTGCCTCTCGAGCACGCTCTGCCTCTT
CCTCACGCCGCTGTCGCTCGAGTGCCGCGAGCTTCGCCTGGTCGTCGGCTTCCCATTGCCGACGCCGCTCCTCCTGCTCGCGACGAAGGGTTTCCATCCG
CTCTTCGGCGACTGCACGCTGGCGCTCGAGCAACTGCGCGGCCTCGAGCTCGACCCGCTGCTGCTGAGCCACGATCTTGGCGCGAATGTCATCCAACTCG
GCGTCGACTATCGGGTGAGAATTCGGTTTGCCATCGACAGTCGGCTCTCTCTCCTCGATTTGAGCTGGTGTCGAGATCACCGCAGATGGAAACGCTGGCG
GTGCTGGACTGGTTAGTCCCTGTGGTCGACTACCAGCAGTGACATCAATTGCTGGCGAAGCTGCTGGTGCCGTCGACGTAGCGCCAGGAGAAGCGAGCGG
TGACGCGGATGTTGAGATCTCTGGCGCGTCTTGTGTCTTCTGCCTCCGGTTAGTCTCTTCGTGGAGCCACTTGCGCTTCTCGAACTCGGCGCGTTGAGCC
TCGTGAGTGCGCACCGCCTCCTGGAACTCGCGCTCAGAGCGCTCAAGCTGCAGTTCGTACGCCGACTTGCGGGCGGCTGGTGGTGGCGCAGACTCGGTCG
TCGTATTGGCTGGTGGTTGCCGATGGTTCGTGGCTGAACNNNNNNNNNNNNNNNGCCGATCGTGGCAGTTCGACCTCGTTGGACACCAGCCCGCTGCTTT
GTTGCTTCGCGCCATTGCTCGTATCTGCTGTCGTCGTGGTCATCGAACTAACATTCGCGGCGCTCGGCGGTCGTTCGACTGGTCGCGAGAGTTTGTCATG
GCTCAATCTCCTCATCGTCGACGGCACCTCCCGTCGCGTGTCTTGTCCTTGATCGTTGACTTCAGCCTCCACCAAATCTCCTGGAGTCTGCTCTTCCCTG
GAGTTCACTAGGAACTCGAGCAGCTCGCCCACAAACGCCTTGGCTTCCTGTCGGAGCTCGTGGCCAGCGCGCAGCCACGACACAAACGCACCGCGCCGCT
CGCTCAAGGTCTGGCGGAGTTGAGCTCGCGTTTTGCCGCGTAGATCGCTTGTGTGCGGCTGCTGGTGCGACCACGCGTGTAGTATCCGCGCGCGACCTTG
GAGGAACGGATCCACGTTGGCCGGCGCGACCAGCGCGTTCTCGACCGACTGCAAGAGAACCAGCGGCACGTCGATCTCAGTCAGTTGGTTCGTGAGATCA
ACGTGGTGCAGCGCGCCTTGACACACACGAATTCGACCCTCGAGCGTGATGGGATTGGTTACAGCCGTGTAAATGCTGAGCGCGAGGTTCGGGTCAATCT
TGCGCAGGTATCCGTCCGAGAACAGGAACTTGCTGAAGAACGACACGGGCAGGTCCGGTCGCGAAGGCGGGAAGCACGAAAACACGTTGACAGCGCTGTG
GAGGATAGCCGCGAGCTGCGCGTCGACGCGTGCGAACCCGTTAAAGAGCGTGAGCGACTGCAGGTCGCCGCCGAACGATTTGCCGTGCAGAATGGTGTAG
CTCGTTGCCACATTTGCGCCGTTGCCAAAGCCGACGATGTGGAACGGGATGCCGTGCGTGATGAACGCCTTGGTTTGCTCCAGATAGTTGAGCAGTTCGT
GCACGCGACGAGCAGTCCACATATTGTTCAGCACCGTCTTCTCTGCGCCGTCTGCACCGAGAGGATCCGTTGCCGACGGATACGACGTGCCTGCCTGGCC
CGGCAAGTTGAACACGAGCACACGAGCGCCGACGTTGCGAGCCAAGAGCGCGCGGAAAAACACCTGCGTGCCGTCGAAAGTGTCGAACAGGTCGTGGAAG
ACCACCAAATTGCATTTGTTAGTGGTCGCCATGGCTTGTCCGACCACTGCGTACGGGATACGAGTGACGCCGTCCTGGCACGTGAAGACGCTGTCGCCAC
CGCTGCCGGTGGCCAGCATATCAGCGAGACCGGAAGGAGCCGCGAGCCGCGACATTTGCTGCGCTTGGATCGAGCGGCGCGCGGCAACTTGACTTTGCTT
TCTGACTGTCCCGAGACCATTTGCCTTGACCGTGGACTGGGTGGATGACTTGCCGCTGCGGGAATGCCCGAAAGCGTCTCGAGAAATCCCCGGTGGTAGC
CTATCCGTATTCAGAAAGCACAGCATTCGACTGGTTTCTAGGTCGCGGATCTGCGGTCGAAGCTTCCAAGCTGCTGTCTGAAGCACCGCGAGAAACCTGC
ACACCGTCATATTCACACACACACACATTGAGTACCCCAATCAATTGTCACAGCATACTCGATTCGCAATTCGTCCATACCAGTTGCAGAACCTAGCAGC
GCAGGCACTGATGGGACCCACGTTTTCGGGGGTGAAAAGCGCGTTGCGAGCGTGTGCGGCACCCTTGAGCAAAACATCCAGTGTGACATCCTCTGCACTG
AACTGCTGCAGCATGGTCAGCAACTTCTCCTGGGAAATCGATCGCTTCAACATATTGATGTCTCCGTCCTTGCCGAGCAGCAGCACGGACAGGGCACTGC
AGACCATTGCAACAGCGGGATGCGGGTTCACAAAGCTGAAAAGCTCGGCCGCGTCATTCTTGGAGATGTTGGTCGCTAGAGTTTGTGCGTGATTCCAGAC
ATGATGCCACACGAACGCATACTCGTCAAATGCGCAATCTTCACCTCCCGTCTCCTCCATTCGCTCATCGAACTCGCTGCTAGTCAGCGAAGGAAGGAGC
AACGAGCCTGTGGATCGATGTGCCCGACTGCCACGTTTTGGAGACATCGCACCATTGCCATTCACTCGAGACTTGCGCTTGCGAGCAACTCGATTGAGCG
CTTCCATTCGAACCTTCTCGACGAGGTTGTAGAACTCGAAGCAGTTCTTACAGACCTGCACCTCCTGGTAATAATAGCCCGGAAAAGTCTGGCCGAGCGG
CTCGCCATCGCCATAGTAGACCTCTGCGAGGTAGTTGCCGTCTTCGCCGTTCTGGTAGCGACGAATGAACAGATCGACGAGCTGCTTCTCCGCGCGAGTC
TGTGCGATCAACTTGAACGGAATCGTGTGGTCGTGCGTGCGGCCCTCGTCAGCTCGCTGTTGTCTCTGCGGCGATCCTGGTTTCGCTCGGCTGAGGTCGT
CGCGGCGCATAATGTCTATGCCAGTGTTGGCAGCTTGCTGTGCCGCGAGGAATGCGTTGGCGGCGGCAGTCGCGCTCACGACACTGGTGTGGCGACTCTT
TCCGGCCAACGTAGCGTGGTCGACAGCAGCGACACCGATCTTCTTGCCACGCTCCATACGTTTGGCGGCAAGGTCTTGCACCGAAAAGTGACAGAAATCA
CCACAGCATCCCTTCTTCTGGCTGGAGACCAAGAAAGCAGCTGATACAGCCCTCCTGCGACCTTGAGATAGTGACGATGTCGGTGGCAAGTCTTGTGCTG
CCTTGTTTTGGTCCTGTGCGTCGCGTAGCTGGCCTCGAGGTCCGGTTTCATCGAACGAGTCGAATGGCGACTGCAGCTGTGCTCCAAGCTTCGATTGCGA
CAAAGATGTCGGGAGCAACGACTTCCGAGTCGGTGTGGGGGCCGCCAGGATTGACTCAATGAGCTGATCATCCGGCCGTCGACATTCCTCCGCCTTGGCC
CGTGCAATGAGCCGTTCGTCGACTGAGCGCGGTCCTTCATACGACGCCAGACTGCTGTTCTCGATCCGTATTGATGACGATGAAGAAGCGGGGAGGGTGG
CACACTCGCGGGTTCGCCACAGGAAGAGCCGCCCAAGATTGTCGAGCACGAACAGCGACACACAGGTGACCACGCGGCACTTCTTACCACGCTCAATGAA
GGAAATGTAGCCCTGCACGAGCTCGTTCACTGCCGCGTTCAGCTTGGCGTCCATGCTCGAGATGCGCTGCCGGCCGAGCGCCACCCGGAAGAGCTTGCCC
TGCGACCGTCCGTTCTTGTGGAGGCTGCTCGCAACGAGCGTTAGCGTCGACAAGACTGCAGGCTCCCATCTAGACCCACGTACGTGTAGTCGTGCTCCAG
GTTGGCGTAGCAAGTCGGGTCGACGTCGCCGCGCGGACAGACAAAGGCGCTGAGGCAAGCACTGCGGTCGCTCGAGCCGAGAGCGGTGAGGAACGTGTCG
AGCTCGTGCGCCGTGAAGAAGGGCGACGCATTGCGCGCGTCATCGTCGAACCAGCAGACCGCGACGTAGCTCGAGCCGGCCCCATCGGTGGCTGCTGCGA
TGGCCTCGAACGCGCGGCGAACCTCCGGAGCCGTGAGCTTGCGCGGGGCCTTGCGGCGAACGATGCCCCCGCTGTTCGAGTAGTACCACGACCAGATCTT
GCGCTTCTCGATGAAGACACTGTCGATGAGCCGCACATTGCACTGATGCCATCAAATATATATATCAGATAAAAGGCCCACACTTCGACATGGAAACATG
GACCTCACCTCGCCTCTGTCACTGTTGACGAGCGCGGAGCACACCCACGACCACGGACGCTGCGTCCGGGGCTCGGCGGGGTCCACGGCCGGCACATTGT
CGCGCACGATCTGTGCATGAGACGCCTGCATCCCGCTTCACCGCTGCCGCCGCCGCCGCCACCAAACGCCTCACACCAGCGGGCCATCACCGTCGCGCGT
CGTATAAATAGCGGTCCGCCGCTGCAACGGTCGCCACAACATGAGACGACGCCGAACGCCCGAACGCCACCCCGCCAACGGCTGAGGATCCAGTACGCCA
GTATTCTTGGCGAGGCTGTCTGCTTGGAGACATCGAGCGATCAACGCCCTTTTCGTGCGGTAGATTTGCTTGAAGGCTTGGCGACATCAACGCCCTTTTC
CTGTGGTAGTTTG