Description :
From Genome Similarity Track
Location :
Scaffold_3:643476- 645863
Transcript NameFunction/comments
Phyca_LT1534503243putative GPI anchor protein
Phyca_LT1534539408deoxycytidylate deaminase

Sequence
2387 bases(100 bases per row)
cgtacacgggtgtgaacgctggtggccctggcacgtacgatcaggtgacggacattgcgtcttgctccaagacgccggtgaccacgtcgaaccccgtgtc
tcctcttgactctggtgtgacgttggctttccgtggttgcatgaccatcttcaacatcgccgtgttcgacggtaccaacggtacgtggagcaaggtctct
tcgtacgagaatggcggtgctgccaccaacatggtgttcctcaacaacgagaacatcgattacaccggtgctggatcccctgagggattctgcgaggctg
acggcacgggtgtcgcccagcagtcgacccctttcagcggaacgttggcatcggcctcgaacccgtccagccagggaatcctcgcttcggaggtgaccgg
tgctgaggtgcacatcatgaccgagaacaagtgcggcgttgacgtcgagtgcgaaggcgcttacgacacggacggcacggctttccagggctggaccggc
agcaaaaagcttttcgtgaccatggtgtcgatggaagaatgcggtgctcccaacgtgcccgctatctggatgctgcccgaccaggtaacccactccggtc
agtacggatgcaactgccgtggcaagggccccgctggcggctgcggtgagcttgacattgctgaggtgctggagaaggacacgagctacgtggccacgca
ctactacttctaccagggcgcctacaacccgggtaacgaccagttctccaagcgcccgacgtctggcccgaccacgtacatcactatcattgacgaggac
tacggtgtcaaggtcattgagatcggcgcagacgacttcgacttctcctgcggcacgatcacccaagacgttgtctcgcagtgggaggccgctgagtaag
tttttgctccacgtagtctcattctgtttctattgtcgataggcttttgtcatcaagtttccccgattgcaggcggatgataatagagctttttgatcca
ttttcatgccatacctttgtattcttccgtcgcttgatgggcgacttttggctgtacgtagttgatttctctacatgaccgaagtaaagtcgatcacaac
cttggaagtttggagctggtgttgcacgtactggacaccggccatgtccaagagccggcgggatgccacgaacctccaactgcagaatgagtcaacacgg
ttagagattcgaccatttcgattcttgggtctgaacgtactcttgattgtacttgtcggaacagtagacgacacgtgagatgccgctctgtaggaacaca
acaccagagcccgttacactattacaacttacacagcgttcgtggtaatgatatacacaaagcgacaagcacctgaataataagcttggcgcattcattg
caaggaaaaagcgccacgtaaatctggataaaatcgggaggttagacaaacgaagagaagtttaacatgcagagccaccagtaccgtgcatcctttaacg
tcggtcgagttcttgttcagtatggcgttcatctccgcatggcaaacatactatagaaaagttagcaccaacaagaaaacatggtttcaagaaggtgttt
ttaccgggtacttggtgtcgaggggcgaattagtctcactctcacgtgcccagggcaactcatcatctccacaaccattagggaatccgttgtatccgat
tccaacgatcttccgctctgggttcacaatacttccaagagcagcattagcactaaaacgccaatccaacacactgccttaccatgccccaacttgagtc
gacggatctacatgtagcacagcaccacaacagccaaaacactatcagcaacaatctacaccccacaagtcacgaaacattccacaaacctttcgagcgc
atggcactcaagaacgccacgctcatgaaataatcgtcccacgacaaatagtcagagcgcttttgcaccgtcgaagatgcagtcgactgctgtgcattca
ctgtactttgctccgtgttgcccgaaacaaagtcattgctggtcacttccccatttctttcctggttatcgttcgcttcggtctctacacgcgcctttgc
tttcccatttttctttggtgtcggagacttagcaccagccaatgcaggagtggggctcgggtgagcctcgcgggtggcggccaccacccaatctgggtgc
ttcaccagaatgtgttgcaccaggttcgtgtacccgtgcttgagtcgttgagcacgtgtcttaccgcacttgcaacggaacatggtgggcgggtccgagt
cctcttcagcactaccagcaggtgcaggccgctctacctccgtatagaatagctccatcatctgccgtccgctgagcttccggtccg