Description :
From Genome Similarity Track
Location :
Scaffold_156:6433- 7853
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_156-abinit-gene-0.42Vacuolar protein sorting-associated protein 8

Sequence
1420 bases(100 bases per row)
GTTCTCTCTGGATCAAATAAGGTAGGTTCGACTACCTCCGAAGAATCAGTTACCACCGCGTTGATCTCTTCATGTCCATTCATTTTTCATACAAAGTCTT
TTGTTTCTTTTCTTCTCGTTCCTGGTCGCGCAACAACAAACCATTTAGACTCACGACCAGCTGTGATTATGTCCCCTCTCTCACCTGCTTAGATCCCGCC
CTTCTGGATCGGGTTGGCGGGCAGCGCACCGGGCTTGCGGTTGCCAATGCGCTTCTTGATCTTGTGCGCCTGCTCCGGGTCGGGCTTGAGCGAAAACACG
GACCGCGAGCTCTTGAGGTACTTGTTGCGCCCGTTCTCCTCGCGAATAAGACTCTCGAGCACCACGTGCGGCGCGACCTGGCGCCGCGAGCTCTTGCGCG
CGTTCTTGAGACGGTTTAGGTACCGCCGCGTGCTCGGCAGCTTCCTCTGAAGGCGGTTGCCAGTCTCGTCGTCTACCACCGCCGCTGTGTCACCTCCTGC
TGGGGTACCGTTCAAGCTGCTCTGTTGACGCGTCGCTGGTTTGGCCTGCGTAACTGGGGCTGTGGTCGACGAGGACGAGTCCACGCCCTGCTGCCACGCC
TTGCCGCACGACTCGTGGAACGCCTGGCCCGACATAATCATGACCATGGATGTCACCAAATTCCACTTCTCGTCGCCCGTCGATCCTGAGTGCGCCATGC
CAAAGGGCGGCTTGGAAAGCACCACCTTGCAGTAGCTGCACGTGTTGGACGGCGGCGCGTAGCACTTGGATTTGGCGCGCTTGAGCGTCGTGATCTGGTC
GAACAGGTCCACGCTGATAAGGCCATTGGCCGTTTGGTAGATGTTCTGCTCGTAGTTGTACGTGTCGAGCATGCCAAAGATCGTCGGGCGGAAGTCGCCA
AACTCGCCCTTGCCGTGCTCGTTCGTGATCTTGAATAGGATCGCCTTGAGCGACACCGATGACGCCATTCGCTCGAGGATGATGCGAATGAGCTCGTTGA
GCGCGACTTGGAACGCCGTCTGCGCGCCACCGCCGCCGCTGCGCGTGGTGATGCGCGCGGTTGACTTGGAGCTCACGGAGCGCTTGACCGCATTCTGGAT
CCGCAGCATCTTGTCCAGCAGCGTAAACCAGAGCTTCTCGGCCTGGTCGTCACGGTTGCGCAGCAAGTTTCGCTGGCACATGGCGAGTGCAACCTCGAGC
GTCTGCATTGCGTCGCGCCCCTCAGGGATGCTCTCAATGATGCTGTCGTTCTGTTGGTGTCTGCTCAGGGCCGTCGACGAGTCGGAAGCAGCCGAGGACG
TAGCGTTGTAACCACGGAGCGCAGGCTTGAGGATCTTGAGCTTCTGCTCAAGGCTCTGCAGGATGAGCGTCAGCGCACCCGTGACATCACCCGTTCGCTC
GAGCAAGTACGCCTCGGCGT